ID: 974783487

View in Genome Browser
Species Human (GRCh38)
Location 4:66585819-66585841
Sequence CCCACAGGGAATTCTGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974783487_974783493 -2 Left 974783487 4:66585819-66585841 CCAACTCCAGAATTCCCTGTGGG No data
Right 974783493 4:66585840-66585862 GGATAGCCTGAGGTCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974783487 Original CRISPR CCCACAGGGAATTCTGGAGT TGG (reversed) Intergenic
No off target data available for this crispr