ID: 974783757

View in Genome Browser
Species Human (GRCh38)
Location 4:66590234-66590256
Sequence TGTTAATTACAGTCACCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974783756_974783757 9 Left 974783756 4:66590202-66590224 CCATTCTAGCTATTTGAAAATAT No data
Right 974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG No data
974783755_974783757 12 Left 974783755 4:66590199-66590221 CCACCATTCTAGCTATTTGAAAA No data
Right 974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974783757 Original CRISPR TGTTAATTACAGTCACCTTA TGG Intergenic
No off target data available for this crispr