ID: 974785014

View in Genome Browser
Species Human (GRCh38)
Location 4:66609060-66609082
Sequence TGAAGAGGGTCCGCATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974785014_974785023 21 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785023 4:66609104-66609126 AACACTTTCTCTGATGGAGGTGG No data
974785014_974785020 15 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785020 4:66609098-66609120 GATACCAACACTTTCTCTGATGG No data
974785014_974785027 30 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785027 4:66609113-66609135 TCTGATGGAGGTGGCTGGGGAGG No data
974785014_974785021 18 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785021 4:66609101-66609123 ACCAACACTTTCTCTGATGGAGG No data
974785014_974785026 27 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785026 4:66609110-66609132 TTCTCTGATGGAGGTGGCTGGGG No data
974785014_974785018 -7 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785018 4:66609076-66609098 CTCTTCAGGTCTCTCAGCCATGG No data
974785014_974785024 25 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data
974785014_974785025 26 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785025 4:66609109-66609131 TTTCTCTGATGGAGGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974785014 Original CRISPR TGAAGAGGGTCCGCATCACA AGG (reversed) Intergenic
No off target data available for this crispr