ID: 974785016

View in Genome Browser
Species Human (GRCh38)
Location 4:66609074-66609096
Sequence ATGGCTGAGAGACCTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 968
Summary {0: 43, 1: 72, 2: 126, 3: 260, 4: 467}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974785016_974785024 11 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data
974785016_974785020 1 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785020 4:66609098-66609120 GATACCAACACTTTCTCTGATGG No data
974785016_974785025 12 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785025 4:66609109-66609131 TTTCTCTGATGGAGGTGGCTGGG No data
974785016_974785021 4 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785021 4:66609101-66609123 ACCAACACTTTCTCTGATGGAGG No data
974785016_974785029 23 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785029 4:66609120-66609142 GAGGTGGCTGGGGAGGTAAAGGG No data
974785016_974785023 7 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785023 4:66609104-66609126 AACACTTTCTCTGATGGAGGTGG No data
974785016_974785028 22 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785028 4:66609119-66609141 GGAGGTGGCTGGGGAGGTAAAGG No data
974785016_974785026 13 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785026 4:66609110-66609132 TTCTCTGATGGAGGTGGCTGGGG No data
974785016_974785027 16 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785027 4:66609113-66609135 TCTGATGGAGGTGGCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974785016 Original CRISPR ATGGCTGAGAGACCTGAAGA GGG (reversed) Intergenic
901036490 1:6339063-6339085 AGGGCAGGGAGACCTGCAGAGGG + Intronic
902412899 1:16221840-16221862 ATGGCTGATGGACATGAGGATGG + Intergenic
902969550 1:20037407-20037429 ATGGCTGAGAGACCTGAAGATGG - Intronic
903240187 1:21977456-21977478 ATGGCAGAGAGACCAGGAAAAGG - Intronic
903243935 1:22002090-22002112 ATGGCAGAGAGACCAGGAAAAGG - Intronic
903339869 1:22647217-22647239 ATGGCTGGGATTCCTGGAGATGG - Exonic
903658572 1:24963580-24963602 CTTGCTGAGAGACCTTAGGAGGG - Intronic
903686815 1:25137741-25137763 TTGGATGAGAGACCAGAAGAAGG - Intergenic
904840916 1:33371302-33371324 ATTGCTGAGAGGACTGAATAAGG + Intronic
906024265 1:42659405-42659427 ATGGTTGACAGACATAAAGAAGG - Intronic
906578817 1:46917509-46917531 ACAGCTAAGAAACCTGAAGATGG - Intergenic
906594525 1:47063026-47063048 ATGGCTAAGAGACCTGAAGATGG + Intergenic
906914719 1:49995832-49995854 ACTGCTGAGAGTCCTGAAAATGG + Intronic
907386290 1:54127686-54127708 ATGGCTGGGAGCCAGGAAGAGGG - Intergenic
908175054 1:61547353-61547375 ATGGCTGAGAGACCCATAGATGG - Intergenic
908829653 1:68166406-68166428 ATGGATGTGAGGCCTGAAGAAGG - Intronic
909347252 1:74605201-74605223 AAGGCTGAGAGAGGTGAAGAAGG - Intronic
909405789 1:75287799-75287821 ACGGCTGAGACACCTAAAGATGG - Intronic
909673643 1:78214849-78214871 ATGGCTGAGAGACCCATAGATGG + Intergenic
909791114 1:79679761-79679783 ATGGCTGAAAGACATGAAGACGG - Intergenic
910142118 1:84037766-84037788 ATTGCTGAGAGACCTGAAGACGG - Intergenic
910323540 1:85977010-85977032 ACAGCTGAGAGACCTGAAAATGG + Intronic
910598392 1:89004738-89004760 ATGGCTCAGAGACCCATAGATGG - Intergenic
911265817 1:95742464-95742486 ACAGCTGAAACACCTGAAGATGG - Intergenic
911562101 1:99418377-99418399 ACGGCTGAAAGACCTGAAGATGG + Intergenic
911743343 1:101411398-101411420 ATGGCTGAGAGACCTGAAGAAGG + Intergenic
912022029 1:105117472-105117494 ACGGCTAAAAGACCTGAAGATGG + Intergenic
912082254 1:105951526-105951548 ATGGCTGAGAGACCAGAAGATGG - Intergenic
912129270 1:106581471-106581493 ATGGCTGCAAGATCTGAAGATGG - Intergenic
912612384 1:111061730-111061752 ATGGCTGAGAGACCTGAAGATGG - Intergenic
912984194 1:114410201-114410223 AGGGCAGAGGGACCTGGAGAAGG + Exonic
913236257 1:116785704-116785726 ACAGCTGAGAGACCTGAAGATGG + Intergenic
913383475 1:118233974-118233996 ATGGATGAAAGACCCAAAGATGG + Intergenic
913463816 1:119117729-119117751 ACAGCTGGGAGAACTGAAGATGG + Intronic
913493572 1:119405505-119405527 ACAGCTGAGAGATCTGAAGACGG + Intergenic
913972988 1:143430241-143430263 ATGGCTGAGAGACCCATAGATGG - Intergenic
914067372 1:144255848-144255870 ATGGCTGAGAGACCCATAGATGG - Intergenic
914111781 1:144710506-144710528 ATGGCTGAGAGACCCATAGATGG + Intergenic
915055470 1:153124731-153124753 ATGGCTGAGAGACCTGAAGGTGG + Intergenic
915521628 1:156448594-156448616 ATGGTTGAGACACATGAACATGG + Intergenic
915883822 1:159701985-159702007 CTTCCTGAGAGGCCTGAAGAAGG + Intergenic
917522971 1:175763244-175763266 GTGGCAGAGAAACATGAAGATGG + Intergenic
917913582 1:179677704-179677726 ATGGCTGCAAGACCTGAAGATGG - Intronic
918070485 1:181130522-181130544 ACAGCTGAGCCACCTGAAGAAGG + Intergenic
918158418 1:181873054-181873076 ATGGCTGAGAGATCCATAGATGG + Intergenic
918171833 1:182004682-182004704 ATGGCTGAGAGACCTGAAGATGG + Intergenic
919073347 1:192783680-192783702 ATGGCTGAGAGACCCACAGATGG - Intergenic
919117918 1:193304551-193304573 ATGGCAGACAGGACTGAAGAGGG - Intergenic
919520482 1:198582100-198582122 ACGGCTATAAGACCTGAAGACGG - Intergenic
920726981 1:208445555-208445577 AAGGCTGAGAGACCCACAGACGG - Intergenic
920799754 1:209174843-209174865 AAGGCTGAGAGAGGTGAGGAAGG + Intergenic
920989869 1:210926354-210926376 ATGGCTGCAAGACCTGAAGATGG + Intronic
921762826 1:218936970-218936992 AAGGACGAGAGACCTGAAGACGG - Intergenic
921842966 1:219847642-219847664 ATAGCTGGGAAACCTGAAGATGG + Intronic
921977695 1:221220501-221220523 ACTGCTGAGAGTCCTGAAGTGGG + Intergenic
922088584 1:222374095-222374117 ATGGCTGAGAGGCTTGAATGGGG - Intergenic
922395952 1:225201716-225201738 GTGGCTGAGAGACCCATAGATGG - Intronic
922762886 1:228143271-228143293 AGGGCAGAGTGACCTTAAGAAGG + Intronic
922884048 1:229004426-229004448 ATGGCTGAGAGAGATAAGGAAGG + Intergenic
923174111 1:231446483-231446505 ATGGCTGGGAGACCTGAAGACGG + Intergenic
923648286 1:235846161-235846183 ATGGCTGAGAGACCCATAGATGG + Intronic
923661681 1:235962540-235962562 ATGGCTGAGAGACCCATAGATGG + Intergenic
923961051 1:239084527-239084549 TGGGCTGAGAGACCTGGAGATGG - Intergenic
924149993 1:241120180-241120202 ATGCCTTAGAGGCCTGAGGATGG - Intronic
924883227 1:248186531-248186553 ATGGCTGCAAAACCCGAAGACGG - Intergenic
1062760864 10:17572-17594 ATGGCTCAGAGACCCAAAGATGG + Intergenic
1063536883 10:6892063-6892085 ACAGTTGAGAGACCTGCAGACGG + Intergenic
1063884848 10:10567193-10567215 ATGGTAGAGACACCTGAAGAAGG + Intergenic
1064366846 10:14716213-14716235 AGGGCTGAGTGACCTAATGAAGG - Intronic
1065462411 10:25982582-25982604 ACAGCTGCAAGACCTGAAGATGG + Intronic
1065470900 10:26080904-26080926 ATGGCTGAGAGACCCATAGATGG - Intronic
1066116320 10:32243453-32243475 ATAGCTGAGACATCTGGAGATGG - Intergenic
1066747152 10:38612061-38612083 ATGGCTGAGAGACCCCTAGATGG + Intergenic
1067034661 10:42904031-42904053 ACAGCTGAGAGACCTAAAGACGG + Intergenic
1068114761 10:52724557-52724579 ACAGTTGAGAGAACTGAAGATGG + Intergenic
1068122786 10:52801014-52801036 ATGACTGAGAGACCTGAAGATGG - Intergenic
1068173107 10:53421902-53421924 ACGACTAAGAGACCTGAAGATGG - Intergenic
1068496126 10:57787141-57787163 AGGTCAGAGAGACCTGGAGAAGG - Intergenic
1068556477 10:58464678-58464700 ATGGCTCGGAGACCTGAAGATGG - Intergenic
1068808591 10:61228531-61228553 ACGGCTGAGAGACCTGAAGATGG + Intergenic
1068925000 10:62527094-62527116 AAGACTGAGACACCTGAAGATGG - Intronic
1069129522 10:64681787-64681809 ATGGCTGTAAGACCTGAAGACGG - Intergenic
1069146295 10:64896080-64896102 ATGCCTGGGAGACCTGAAGATGG - Intergenic
1069160458 10:65085146-65085168 ACAGGTGAGAGACCTGAAGATGG + Intergenic
1069774384 10:70918311-70918333 AGGGCTGAGTGACCTGAGGCAGG - Intergenic
1070464982 10:76712118-76712140 ATGGCTGAGAGACCTGCAGACGG + Intergenic
1071015813 10:80996475-80996497 ACAGCTGAGAGACCTGAAGATGG - Intergenic
1071335650 10:84598314-84598336 ATGGCAGACTGACCTGCAGAAGG - Intergenic
1071405762 10:85329697-85329719 ATGGCTGAGAGACCCATAGATGG - Intergenic
1071761346 10:88611053-88611075 ACAGCTGCAAGACCTGAAGATGG + Intergenic
1071870501 10:89789359-89789381 ATGCCTGAGAGACCTAAAGATGG - Intergenic
1072197726 10:93130875-93130897 ATGGCTTAGGCAGCTGAAGATGG - Intergenic
1072814948 10:98498285-98498307 ATGGCTGAGGGACCCATAGATGG + Intronic
1072961068 10:99929684-99929706 ATGGCCCAGAGACTTGGAGAAGG - Intronic
1073204941 10:101763859-101763881 AGGGCAGGGAGACCTGAGGATGG - Intergenic
1074037319 10:109753524-109753546 ATGACTGAGATACCTGAAGATGG - Intergenic
1075010166 10:118861224-118861246 CTGGCTGAGATCCCTGAGGAAGG + Intergenic
1075242076 10:120788134-120788156 ATGGCTGTGGGACCTTAAGCAGG + Intergenic
1075660558 10:124192934-124192956 ATGGCTGAGAGACCCATGGATGG - Intergenic
1075946859 10:126440679-126440701 ATGGCTGAGAGACCCACAGACGG + Intronic
1077018054 11:405644-405666 AAGGCTGAGAGAGCCGCAGAGGG + Intergenic
1077147774 11:1053598-1053620 GTGGCTGAGAGGACTGAGGACGG + Intergenic
1077300371 11:1843950-1843972 TTGGCTGAGGGACATGAGGAAGG + Intergenic
1077774857 11:5259170-5259192 ATGGCTGAGAGACCCACAGATGG + Intronic
1077827950 11:5831155-5831177 ACAGTTGGGAGACCTGAAGATGG - Intronic
1079273653 11:19013240-19013262 AAGGCTGAGAGACCCACAGATGG - Intergenic
1079398940 11:20090050-20090072 GGGGCTGAGAGAACTAAAGAAGG + Intronic
1079415829 11:20235595-20235617 ATGGCTGGGAGACCTGAAGATGG + Intergenic
1079464107 11:20712828-20712850 ACAGCTGGGAGACCTGAAGATGG - Intronic
1079806022 11:24932107-24932129 ATGGCTGAGAGACCTGAAGATGG - Intronic
1079856578 11:25612379-25612401 ACAGCTGAGAGATCTGAAGATGG - Intergenic
1079952106 11:26818868-26818890 ATGGCTGAAAGACCCACAGATGG - Intergenic
1080567661 11:33526462-33526484 ATAGCTGGGAGACCTGAAGACGG + Intergenic
1080864031 11:36177676-36177698 ACGGCTGAGAGACGTGAAGATGG - Intronic
1081091065 11:38867077-38867099 ATGGCTGAAAGACATGAAGATGG - Intergenic
1081725157 11:45322771-45322793 ATGGGAGAGAGAACTGAAGGGGG - Intergenic
1082113072 11:48298482-48298504 ACAGCTGGGAGACCTGAAGATGG - Intergenic
1082140431 11:48602913-48602935 ATGGCTGAGAGATCCATAGATGG - Intergenic
1082567620 11:54700013-54700035 ATGGCTGAGAGATCCATAGATGG - Intergenic
1083983173 11:66191193-66191215 ATGGCTGATGGCCTTGAAGATGG - Intronic
1084041897 11:66547252-66547274 AGGGCTGGGAGCCCTCAAGAGGG + Intronic
1084106182 11:66982222-66982244 CTGGCTGAGTGCCCAGAAGAAGG - Intergenic
1084491558 11:69481380-69481402 TTGCCTGGGAGACCTGAAGTTGG - Intergenic
1084955883 11:72691358-72691380 ATGGCTGAGGTACCTGGAAAGGG - Intronic
1085737597 11:79052713-79052735 TTGGCTGAGAGGCCAGCAGATGG - Intronic
1085917209 11:80903778-80903800 ATGGCTGAGAGACCCACAGATGG + Intergenic
1086264655 11:84983279-84983301 ATGGCTGAGAGACCCACAGACGG + Intronic
1086315622 11:85589021-85589043 ATGGCTGGGAGACCTGAAGGTGG - Intronic
1086869296 11:92017795-92017817 ATGGCTGGGAAACCTGAAGATGG - Intergenic
1087610047 11:100423006-100423028 ACAGCTGAGAGACCTGAAAATGG + Intergenic
1087619537 11:100525961-100525983 ATGGCTGAGAGACCCATAGATGG + Intergenic
1087789793 11:102393819-102393841 ATTCCTGAGACACCAGAAGATGG - Intergenic
1087804383 11:102539647-102539669 ATGGCTAAGAGACCTGAAGATGG + Intergenic
1088223662 11:107594432-107594454 ATGGAAGAGAGAGCTGAAAAGGG + Intronic
1088413677 11:109566392-109566414 ACAGCTGAGAGACCTGAAGATGG - Intergenic
1088730438 11:112677059-112677081 ATGGCTGAGAGACCCATAGATGG - Intergenic
1088789093 11:113208439-113208461 ATGTCTGAGGGACATGAAGAAGG - Intronic
1088800094 11:113297464-113297486 CCAGCTGGGAGACCTGAAGATGG + Intergenic
1088951218 11:114572040-114572062 AAGGCTGCAAGACCTGAAGATGG + Intronic
1089107437 11:116024402-116024424 ATGGCTGAGAGACTCATAGACGG + Intergenic
1089373847 11:117980246-117980268 AGGGCTGAGAGTCTTGTAGATGG - Intergenic
1089797210 11:120990631-120990653 ATTGGTGAGTGACCTGGAGAGGG + Intergenic
1089952846 11:122546332-122546354 ATGGCTGAGAGACCCATAGAGGG - Intergenic
1090307332 11:125702629-125702651 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1090682694 11:129078109-129078131 ATGGCTGAGAGACCTGAAGATGG + Intronic
1090905796 11:131073601-131073623 ATGGCTGAGATTTCTGAGGAGGG + Intergenic
1090954470 11:131502220-131502242 ATGGCAGAGAGGCCTCATGAAGG + Intronic
1091932637 12:4408948-4408970 ATTATTGAGAAACCTGAAGAAGG + Intergenic
1092245530 12:6861984-6862006 ATGGGTGTGAGACCTGAAAAAGG + Intronic
1093001992 12:14007466-14007488 ATGGCTAAGAGACCCATAGACGG - Intergenic
1093111422 12:15157022-15157044 ATGTCTGACAGACTTGAAGATGG - Intronic
1093409207 12:18844945-18844967 ATGGCTGAGAGACCCATAGACGG - Intergenic
1093594599 12:20945584-20945606 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1093604442 12:21073401-21073423 ATGGCTGAAAGACCTGAAGATGG - Intronic
1093991478 12:25593349-25593371 ATGGCTGAGAGATCCACAGATGG + Intronic
1094054323 12:26253447-26253469 ATGGCTGATAATTCTGAAGATGG + Intronic
1094263394 12:28527454-28527476 ATGGCTGAGAGACCCAAAGATGG - Intronic
1094362172 12:29641381-29641403 ATGGCTGAGAGACCCATAGACGG + Intronic
1094447300 12:30545877-30545899 ATAGCTGAGAGACCTATAGATGG - Intergenic
1094802209 12:34049291-34049313 ATGGCTGAGAGACCCACAGATGG + Intergenic
1094808598 12:34115275-34115297 ATGGTTGAGAGACCCATAGATGG + Intergenic
1095115346 12:38345201-38345223 ATGGCTGAGAGACCCATAGATGG + Intergenic
1095178649 12:39122400-39122422 ATGGCTAAGAGGCCTAAAGATGG - Intergenic
1095225871 12:39675743-39675765 ACAGCTGGGAGACCTGAAGATGG + Intronic
1095732751 12:45522750-45522772 ATGACTGAGAGACCCATAGAAGG + Intergenic
1096230104 12:49892035-49892057 ATGGGTGAGAGAACCGAGGAAGG - Intronic
1097092452 12:56518013-56518035 GTGGCTAAGAGACCTGAACAAGG - Intergenic
1097302466 12:58033737-58033759 ATGCCTGAGAGACCTGAAGATGG - Intergenic
1098500659 12:71187837-71187859 ATGGCTGAGAGACCTGAAGATGG + Intronic
1098982623 12:76973909-76973931 ATGGCTGAGAGACCCATAGATGG - Intergenic
1099382408 12:81971093-81971115 ATGGCTAAGAGACCTGAAGACGG + Intergenic
1099392376 12:82097486-82097508 ACAGCTGAGAGACCTGAAGATGG - Intergenic
1099472983 12:83074326-83074348 ACGGCTGAGAGACCCACAGATGG - Intronic
1099687383 12:85907751-85907773 CAGGCTGAGAGACCCAAAGATGG - Intergenic
1100203538 12:92325102-92325124 GTGGCTGAGAGACCCACAGATGG - Intergenic
1100516398 12:95332353-95332375 AAGGCTGAGAGAGATGAGGAAGG - Intergenic
1100669458 12:96795091-96795113 ATGGCTGAGAGACCTGAAGGTGG - Intronic
1100684295 12:96969413-96969435 ATGGCTCAGAGACACGAACAAGG - Intergenic
1100918609 12:99456065-99456087 ACAGCTGAGAGACCTGAAGATGG + Intronic
1100937111 12:99681477-99681499 ACAGCTGAGAGAACTGAAAATGG + Intronic
1101526761 12:105538201-105538223 AAGGCTGTGTGAACTGAAGATGG + Intergenic
1103505866 12:121442204-121442226 GTGGCTGAGGTAGCTGAAGACGG + Exonic
1103561751 12:121796509-121796531 ATGCCTGAGAACCCTGCAGAGGG + Intronic
1103761047 12:123250706-123250728 ATGGCTGAGAGACCCATAGATGG - Intronic
1103868461 12:124073107-124073129 TGGGCTGAGAGACCTGAAGGAGG - Intronic
1104504452 12:129318495-129318517 ATGGATGAGAGACCCATAGATGG - Intronic
1104618652 12:130292657-130292679 ATGGCTCAGGTCCCTGAAGAGGG + Intergenic
1104903654 12:132202337-132202359 GTGTCTGAGAGACGAGAAGAGGG - Intronic
1105598806 13:21866801-21866823 ATGGCTGACAGACCTGAAGACGG - Intergenic
1105831405 13:24165544-24165566 AGGGCTGAGAGAGGAGAAGAGGG - Intronic
1105930825 13:25049811-25049833 ATGGCTGAGAGACCCATAGACGG + Intergenic
1106978084 13:35246636-35246658 ACGACTGAGAGAACTGAAGATGG - Intronic
1107184882 13:37506137-37506159 ATGGCTGAGAGACCCATAGATGG + Intergenic
1107361233 13:39619452-39619474 ATAGCTGGGAGATCTGAAGATGG + Intergenic
1107858804 13:44641662-44641684 AGGGATGAGAGCCCTGAAGGTGG - Intergenic
1108901104 13:55410053-55410075 ACAGCTGAGAGACCTGAAGATGG - Intergenic
1109194988 13:59368851-59368873 AGGGCTGAGAGAGCAGAGGAGGG - Intergenic
1109597017 13:64569915-64569937 ATGGGTGAGAGACCTGAAAATGG - Intergenic
1109834675 13:67841333-67841355 ATAGCTGAGACATCTGGAGATGG - Intergenic
1109854082 13:68106471-68106493 ATAGCTGAGACATCTGGAGATGG + Intergenic
1110375915 13:74793951-74793973 GTGGCTGCAAGACCTGAAGATGG - Intergenic
1110504792 13:76272561-76272583 ACAGCTCAGAGACCTGAAGATGG + Intergenic
1110599662 13:77358299-77358321 TTGGCTGAATGACCAGAAGATGG - Intergenic
1111051479 13:82887294-82887316 ATGGCCGAGAGACCAATAGATGG + Intergenic
1111510087 13:89250011-89250033 ATGGCAGACAGACTTGAAAAAGG + Intergenic
1112035298 13:95492017-95492039 ATGGCTGAGAGACCCACAGACGG - Intronic
1112738140 13:102443774-102443796 ACGGCTGAGAGACCCATAGACGG + Intergenic
1113472261 13:110555440-110555462 ATGGCTGAGCCACCTGAGAAGGG - Intronic
1113534905 13:111058431-111058453 ACAGCTGAGAGACCTGAAGATGG - Intergenic
1114692257 14:24595116-24595138 ATGGCTGAGAGGCCCATAGATGG - Intergenic
1115263307 14:31475123-31475145 ATGCCTGAGAGACATTAAAATGG - Intergenic
1115527180 14:34293093-34293115 ATGGCTGAGAGACCCATAGATGG - Intronic
1116048979 14:39780874-39780896 ATAGCTAAGAGACCTATAGATGG - Intergenic
1116063960 14:39958759-39958781 ATGGCTGTAAGACCTGAAGACGG + Intergenic
1116499377 14:45601943-45601965 AAGGCTGAGAGAGGTGAGGAAGG - Intergenic
1116828650 14:49696105-49696127 CTGGCTAAGATACCTGATGAAGG - Intronic
1117112818 14:52475967-52475989 ATGGCTGAGAGACCCACAGATGG + Intronic
1117182287 14:53202968-53202990 ATGGCTGAGAAACCTGAAGATGG + Intergenic
1117193372 14:53316079-53316101 ATGTCTGGGAGACCAGAAGACGG - Intergenic
1117510733 14:56448491-56448513 ATGACTGAGAGACCCACAGATGG - Intergenic
1117590236 14:57259909-57259931 ATGGCTGAAACCCCTGCAGAGGG + Intronic
1118140142 14:63071958-63071980 ATGGCTGAGAGACCTGAAGATGG - Intronic
1118532055 14:66717857-66717879 ACGGCTGAGAGACCCATAGACGG - Intronic
1119582627 14:75800820-75800842 ATGGCTGAGAGACCTGAAGATGG - Intronic
1120605379 14:86570058-86570080 ACAGCTGAGAGACCTGAAGAAGG - Intergenic
1120736288 14:88057110-88057132 ATGGCTGCGAGACCTGAAGATGG - Intergenic
1121503413 14:94458362-94458384 ATGGCTGAGAGACCTGCAGATGG - Intergenic
1121516543 14:94556084-94556106 ATGGCTGAGAGACCCACAGAGGG - Intergenic
1121810029 14:96877355-96877377 ATACTTGAGATACCTGAAGAGGG + Intronic
1121848383 14:97196089-97196111 ATGGCTGCAAGACCTAAAGATGG - Intergenic
1122298310 14:100717819-100717841 AGGGCTGGGAGACCTGCAGAGGG - Intergenic
1123063261 14:105603967-105603989 CTGGGGGAGAGACCTGACGACGG - Intergenic
1123087323 14:105722753-105722775 CTGGGGGAGAGACCTGACGACGG - Intergenic
1123834401 15:24173490-24173512 GTGGCTGGTAGACCTTAAGATGG - Intergenic
1124380782 15:29162949-29162971 ATGGCTGAGAGACCCATAGACGG + Intronic
1126328291 15:47505269-47505291 AGTGCTGGGAGACCTGATGAAGG - Intronic
1126572775 15:50169319-50169341 ACGGCTGAGAGACCCATAGACGG + Intronic
1126997352 15:54460243-54460265 ATGGCTGGGAGACATGAAGATGG - Intronic
1127008153 15:54594177-54594199 ATGGCTGAGAGACCCATAGATGG - Intronic
1127014537 15:54668858-54668880 ATACCTGAGAGTCCTGAAGATGG + Intergenic
1127574006 15:60272647-60272669 ATGACTGAGAGACTTGAAGATGG - Intergenic
1130885290 15:88087593-88087615 ATGGGTGAGAGAGCTGAAGGAGG + Intronic
1131431364 15:92391981-92392003 ATGGTTGGGATACCTGAATAGGG - Intergenic
1132412805 15:101597379-101597401 GTGACTGAGAGACCTGAAGATGG - Intergenic
1132486954 16:198315-198337 ATGTCTTAGAGTCTTGAAGAAGG + Intronic
1133092992 16:3419454-3419476 AAGGCTGAGAGAGGTGAAGAAGG - Intronic
1133205892 16:4233298-4233320 CAGGCAGAGACACCTGAAGATGG - Intronic
1133239118 16:4404218-4404240 ATGGCTGAGAGGCCTGGGAATGG - Intronic
1133283031 16:4677705-4677727 ATGGCTGTGAGGCATGAAGGGGG + Intronic
1133986568 16:10673524-10673546 AAGGGTGAGATACCTGGAGAAGG - Intronic
1135244006 16:20838724-20838746 AAGGCTGACAGGACTGAAGAAGG - Intronic
1135883172 16:26279276-26279298 ATGGCTGAGAGACCTGAAGATGG - Intergenic
1135901657 16:26465217-26465239 ATGGCTGAGAGTCCCATAGATGG + Intergenic
1136712311 16:32249221-32249243 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1136735915 16:32467583-32467605 ATGGCTGAGAGACCCATAGATGG - Intergenic
1136755604 16:32680184-32680206 ATGTCTCAGATAGCTGAAGATGG + Intergenic
1136812509 16:33190188-33190210 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1136818985 16:33300268-33300290 ATGTCTCAGATAGCTGAAGATGG - Intronic
1136825548 16:33356801-33356823 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1136830614 16:33455572-33455594 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1137806279 16:51309073-51309095 ATTGCTCAGAGAACAGAAGATGG - Intergenic
1138222115 16:55260753-55260775 ATGGTGGAGAGAGCTGAAGGAGG - Intergenic
1138424301 16:56920452-56920474 ATGGCAGGGAGACCAGAGGAGGG + Intergenic
1138797911 16:59992871-59992893 AAGGCTGAGAGACCCATAGACGG - Intergenic
1202991086 16_KI270728v1_random:13158-13180 ATGTCTCAGATAGCTGAAGATGG - Intergenic
1203017160 16_KI270728v1_random:361991-362013 ATGGCTGAGAGACCCATAGATGG + Intergenic
1203035495 16_KI270728v1_random:635149-635171 ATGGCTGAGAGACCCATAGATGG + Intergenic
1203057746 16_KI270728v1_random:940539-940561 ATGTCTCAGATAGCTGAAGATGG + Intergenic
1142563796 17:826674-826696 AGGGCTGAGGGACCTGGTGAAGG - Intronic
1143957122 17:10679715-10679737 ATGGCTGACACACCAAAAGAAGG + Exonic
1144741891 17:17588425-17588447 AAGGCTGAGAGACCTGGGGCAGG - Intronic
1146830999 17:36069671-36069693 ATGGCTGAGACCCCAGAAGGAGG + Intronic
1147346077 17:39796346-39796368 ATGGCTTGGAGACTGGAAGAAGG - Intronic
1147899140 17:43772517-43772539 ATGGCTGAGGGTACTCAAGAGGG - Intronic
1148166960 17:45490509-45490531 AGGGCTGAGGGCCCTGAAGCCGG + Intronic
1148400557 17:47356573-47356595 ACGGCTGAGAGACCTGAAGATGG - Intronic
1148440627 17:47709987-47710009 AGGGCTCTGAGGCCTGAAGAAGG - Intronic
1148789169 17:50163864-50163886 ATGGCTGAGGGGCCTGAGAAGGG + Intergenic
1149221466 17:54418968-54418990 ACAGCTTAGAGACCTGAAGACGG + Intergenic
1149976954 17:61275621-61275643 ATGGTTGACTGACCTGCAGAAGG + Intronic
1150334832 17:64323089-64323111 AAGGCTGAAAGACAGGAAGATGG - Exonic
1150893718 17:69184519-69184541 ACGGCTGCGAGACCTGAAGATGG + Intronic
1151078870 17:71305089-71305111 ATGGCTGAAAGACCTGAAGATGG + Intergenic
1151174150 17:72273427-72273449 CTGGCTCAGAGGCCTGAGGATGG - Intergenic
1151405333 17:73882463-73882485 AAGGCTCAGAGATCTGGAGAGGG - Intergenic
1152953771 18:17926-17948 ATGGCTCAGAGACCCAAAGATGG + Intergenic
1153400538 18:4679395-4679417 ATGGCTGAGAGACCCAGAGATGG + Intergenic
1153738170 18:8094953-8094975 CAGGCTCAGAGACCTTAAGATGG - Intronic
1153828829 18:8901496-8901518 ATGGCAGGAAGACCTAAAGAAGG + Intergenic
1154297939 18:13166315-13166337 ATGGTTGAGAGACCTGAAGATGG + Intergenic
1156020978 18:32598595-32598617 ATGGCTGGGAGATTTGAAGATGG + Intergenic
1156487083 18:37473137-37473159 ATGGCTGAGAGCCAGGAAGGAGG - Intronic
1156607057 18:38679436-38679458 ACAGCTGCAAGACCTGAAGATGG - Intergenic
1156893306 18:42215177-42215199 ATGCCTGAGAGACCTGAAGGTGG - Intergenic
1158002673 18:52636957-52636979 ATGGCTGAGAGACCCATAGACGG + Intronic
1158097707 18:53793123-53793145 ACGGGTGAGAGACCTGAAGATGG + Intergenic
1158204586 18:54978439-54978461 AAGGCTGAGAGAGGTGAGGAAGG - Intergenic
1158331454 18:56367719-56367741 GTGGCTGAGAGACCCATAGACGG - Intergenic
1158377260 18:56884930-56884952 ATGGCTGAGAGACCTGAAGACGG + Intronic
1158756548 18:60332217-60332239 ATGGCTGAGAGACCCATAGACGG + Intergenic
1158829821 18:61264453-61264475 ACGGCTGAGAGACCCATAGATGG + Intergenic
1158898829 18:61941744-61941766 ATGGCTGAAAGACATTAACAGGG + Intergenic
1159612840 18:70545925-70545947 ATGGTTGAGAGACCTGAAGAAGG - Intergenic
1159838505 18:73369763-73369785 ATGGCTGAAAAACCTGAAGATGG + Intergenic
1160058725 18:75510205-75510227 ATGGCTGGGAGACCAGAACATGG + Intergenic
1160267536 18:77353408-77353430 ATGGCTGAGAGACCCACAGATGG - Intergenic
1164108057 19:22126073-22126095 ATGGCTGAGAGACCTGCAGATGG + Intergenic
1164157525 19:22605590-22605612 ATGGCCGAGAGTCCTGCAGTAGG + Intergenic
1166899690 19:46049954-46049976 ACGGTTGAGAGACCTAAAGACGG + Intronic
1167803278 19:51760515-51760537 ATGGCTCACAGAACTTAAGAAGG - Intronic
925343378 2:3151797-3151819 ACGGCTGAGAGACCCACAGATGG + Intergenic
925652262 2:6103973-6103995 ACGGCTACAAGACCTGAAGATGG - Intergenic
925705600 2:6681852-6681874 ATGGCTGAGAAACCTGAAGGTGG + Intergenic
926560241 2:14408791-14408813 ACGGCTGAGAGACCCATAGATGG + Intergenic
928472998 2:31592490-31592512 ACAGCTGAGAGACCTGAAGCTGG + Intergenic
928973465 2:37057383-37057405 ATGGCAGAGGGATCTGAGGAGGG + Exonic
930421949 2:51165317-51165339 ACAGCTGGGAGACCTGAAGATGG - Intergenic
930423014 2:51177290-51177312 ACAACTGAGAGACTTGAAGATGG + Intergenic
930448604 2:51505889-51505911 ATGGCTGCAAAACCTGAAGACGG + Intergenic
930574239 2:53126925-53126947 ATGGCTGAGAGACCTGAAGATGG - Intergenic
930720215 2:54631077-54631099 AAAGCTGAGTGACCTGCAGAAGG + Exonic
930945501 2:57068809-57068831 ATGGATTAAAGACTTGAAGAGGG + Intergenic
931086993 2:58843430-58843452 ATGGCTTAAAGACCTCAACAGGG + Intergenic
931136930 2:59413918-59413940 ACAGCTGAGAGACCTGCAGATGG - Intergenic
931279528 2:60777043-60777065 AAGGCTGAGAGAGGTGAGGAAGG - Intronic
931547938 2:63409187-63409209 ACGGCTGAGAGACCCACAGATGG + Intronic
932215412 2:69963020-69963042 ATGGCATAGGGAGCTGAAGAGGG - Intergenic
932270430 2:70404083-70404105 ACGGCTGAGAGACCCATAGACGG + Intergenic
932449233 2:71799021-71799043 ATGGCTGGGAGACCAGGAGAAGG + Intergenic
932604994 2:73159281-73159303 GTGGCTGGGAGACGGGAAGAAGG + Intergenic
932925544 2:75969347-75969369 ATGGCTGGGAGACCTGAAGATGG + Intergenic
933086353 2:78058968-78058990 CTGTCTGGGAGACCTGAAGATGG - Intergenic
933110807 2:78397582-78397604 AGGGCTGAGAGACCTGAAGATGG + Intergenic
933136318 2:78740318-78740340 AAGGCCTAGAGACCTCAAGATGG + Intergenic
933474435 2:82771278-82771300 ATGCCTGGAAGACCTGAAGATGG + Intergenic
934177685 2:89591197-89591219 ATGGCTGAGAGACCCATAGATGG - Intergenic
934187081 2:89756693-89756715 ATGGCTGAGAGATCCATAGATGG - Intergenic
934287984 2:91665498-91665520 ATGGCTGAGAGACCCATAGATGG - Intergenic
934309554 2:91851232-91851254 ATGGCTGAGAGAACCATAGATGG + Intergenic
935007186 2:99090052-99090074 ATGGCTGAGAGACCAGAAGATGG + Intronic
936431881 2:112471853-112471875 CTGGCTGAGAGCAGTGAAGAAGG + Intergenic
936504905 2:113098442-113098464 ATGGCTGACAGACCTGAAGACGG - Intergenic
936705243 2:115064773-115064795 GTGGCTGAGGGACCAGTAGATGG + Intronic
937410506 2:121670615-121670637 ATAGCTGGGAGACCTGAAGATGG + Intergenic
937521854 2:122721282-122721304 ATGGCTAAGAGACCCATAGATGG + Intergenic
937529341 2:122809150-122809172 ATGGCTGAGAGACCAATAGACGG + Intergenic
937561544 2:123230890-123230912 ATGGTAGAGAGACCTGAAGACGG - Intergenic
937798907 2:126058912-126058934 ATGGCTGAGAGATCTGAAGATGG - Intergenic
937828889 2:126399053-126399075 ATGGCTGAGAGACCCACAGATGG - Intergenic
938175515 2:129123700-129123722 ATGCCTGAGAGACCTGAAGATGG - Intergenic
938497473 2:131808029-131808051 ATGGCTGAGAGACCCATAGATGG + Intergenic
938599502 2:132822346-132822368 ATGGCTGAGAGACCTGAAGATGG + Intronic
938782800 2:134600723-134600745 TTACCTGAGAAACCTGAAGAAGG - Intronic
939219408 2:139282059-139282081 ATGGCTAGGAGACATGAAGATGG + Intergenic
939564778 2:143774211-143774233 CTTGGTAAGAGACCTGAAGAAGG + Intergenic
939797523 2:146664955-146664977 ATGGCTGAGAGACCTTGGGTGGG - Intergenic
939919207 2:148087505-148087527 ATGGCTGGGAGACCGGAGTATGG + Intronic
940089905 2:149903474-149903496 ATGGCTAATAGACATGAAAAAGG + Intergenic
940172308 2:150842715-150842737 ATGGCTGAGAGACCCACAGATGG - Intergenic
940217589 2:151316144-151316166 ACGGCTGAGAGACCCACAGACGG + Intergenic
940709334 2:157143676-157143698 ATGGCTGAGAGACCCATATATGG - Intergenic
940746616 2:157574755-157574777 ATGGGAAAGAGATCTGAAGATGG + Intronic
940796746 2:158088832-158088854 ACAGCAGGGAGACCTGAAGACGG - Intronic
941357942 2:164515351-164515373 ATGGCTGAGAGACCTGAAGATGG + Intronic
941593790 2:167451546-167451568 ATGGCTGAGAGACCTGCAGATGG - Intergenic
941702168 2:168615006-168615028 ATAGCTGAGAAATCTGCAGATGG + Intronic
942677484 2:178443696-178443718 ATGGCAGTGAAACCTGTAGATGG - Intronic
942726114 2:179009615-179009637 AAGGTTGAGAGACCTATAGATGG - Intronic
943348780 2:186772635-186772657 ACGACTGAGAGACCTGAAGATGG + Intergenic
943654331 2:190491448-190491470 CCAGCTGAGAGACCTAAAGATGG + Intronic
943909377 2:193543027-193543049 AAAGCTGAGAGACCTGCAGATGG + Intergenic
943943581 2:194029649-194029671 ACAGCTGGGAGACCTGATGATGG + Intergenic
944073004 2:195694600-195694622 ACAGCTGACAGACCTGAAGGTGG - Intronic
944485445 2:200200247-200200269 ACAGCTGAAAGACCTGAAGATGG + Intergenic
944528816 2:200648441-200648463 ATAGCTGAGAGACCCATAGACGG - Intronic
944873990 2:203943508-203943530 ATGGCTGAGAGACCCATAGATGG - Intronic
945120533 2:206452748-206452770 ATGGCTGAGAAAGATGAGGAAGG - Intronic
945285658 2:208078803-208078825 ACAGCTGAGAGATCTGAAGATGG + Intergenic
945338205 2:208617937-208617959 ATACCTGGGAGACCTGAAGACGG - Intronic
945362383 2:208907130-208907152 ATGGCTGAGAGACAAGAAGATGG + Intergenic
945708768 2:213269456-213269478 TTGCCTGAAAGAGCTGAAGAGGG + Intergenic
945754778 2:213832416-213832438 AGGGATGAGAGACAGGAAGACGG - Intronic
946787291 2:223261150-223261172 ATGGCAGATAGACTTTAAGATGG + Intergenic
947382208 2:229555423-229555445 ATGGCTGTAAGACTGGAAGAAGG - Intronic
947573117 2:231250781-231250803 CTGGAGGAGAGACCTGAAGCAGG + Intronic
948506508 2:238431320-238431342 AAGCCTGAGAGAGCTGAGGAAGG - Intronic
948531257 2:238607045-238607067 ATGGTTGAGAAAATTGAAGATGG + Intergenic
948576788 2:238956931-238956953 ACAGCTGAAAGGCCTGAAGATGG + Intergenic
948707876 2:239806430-239806452 AGGGCTCAGAGACCAGAAGCAGG - Intergenic
1169397849 20:5250667-5250689 ATGGCTGAGAGACCTGAAGTTGG - Intergenic
1169517398 20:6332872-6332894 ATGGCTGAGAGACTCATAGATGG - Intergenic
1169769191 20:9182786-9182808 ATGGCTGAGACAGCTGAGAAGGG - Intronic
1170126529 20:12970023-12970045 AGGGGTCACAGACCTGAAGAAGG + Intergenic
1170241692 20:14173972-14173994 ATGGTTGAGAAACCTGAAAATGG - Intronic
1170245699 20:14219877-14219899 ATGGCTGAGAGACCCACAGATGG - Intronic
1170543421 20:17411636-17411658 CTGTCTGACAGATCTGAAGAGGG + Intronic
1170794315 20:19533141-19533163 GTGCATGAGAGACCTGAAGCAGG - Intronic
1170863093 20:20127571-20127593 ACGGCTGAGAGACCCACAGATGG - Intronic
1171027841 20:21648312-21648334 ATGGCTGAGAGACCCAAAGATGG + Intergenic
1171198473 20:23222457-23222479 ACAGCTGGGAGACCTGAAGATGG - Intergenic
1172038365 20:32026371-32026393 ATGGCTGCAAGTCCTGAAGAGGG - Intronic
1172483640 20:35286153-35286175 AGGGCAGAGAGTCCTGGAGAAGG - Exonic
1172765453 20:37348348-37348370 ATGGCTCAGTGACCTGTTGAGGG + Intronic
1172851379 20:37968779-37968801 ATGGCTGCAACACCTGAAGATGG - Intergenic
1173871734 20:46346351-46346373 ATGGCTGGGAGACCGGAGGCTGG + Intronic
1176361231 21:5998415-5998437 ATGGCAGAGAGGCCTGGAGTGGG + Intergenic
1177127800 21:17217440-17217462 ATGGCTGCAAGACCTGAAGATGG + Intergenic
1177140578 21:17353406-17353428 ATGGCTGAGAGACCCACAGACGG + Intergenic
1177364472 21:20116758-20116780 ATGGCTGGAAGACCTGAAGATGG - Intergenic
1177578955 21:22994526-22994548 ACGGCTGAAAGACCTGAAGATGG + Intergenic
1177657328 21:24035506-24035528 ATGGCTGGGAGACCTGAAGATGG + Intergenic
1177661267 21:24086277-24086299 ATGGCTGAGAGATCTAAACATGG + Intergenic
1177832784 21:26158127-26158149 CTGGCTGAGAGAACTCTAGATGG - Intronic
1177919315 21:27130845-27130867 AAGGCTGTGAGAACTGATGAAGG - Intergenic
1178038259 21:28609189-28609211 ATGACTAGGAGACCTGAAGATGG + Intergenic
1178059442 21:28835281-28835303 ATGGCTGAGAGACACATAGATGG + Intergenic
1178659888 21:34498552-34498574 ATGGCTAGGAGACCTGAAAATGG - Intergenic
1178959098 21:37047652-37047674 ATGACTGAGAGACCCATAGATGG + Intergenic
1179762287 21:43540135-43540157 ATGGCAGAGAGGCCTGGAGTGGG - Intronic
1180039929 21:45270689-45270711 ATGGCTGGGAGACCCGAAGACGG + Intronic
1180536647 22:16398369-16398391 ATGTCTGAGAGACCCATAGATGG + Intergenic
1180896380 22:19336678-19336700 ACAGCTGGGAGATCTGAAGATGG + Intronic
1181909906 22:26230394-26230416 ATGACTGAGCGACCTGACCAGGG - Intronic
1183048308 22:35240105-35240127 ATGGCTGAGAGACCCATAGATGG - Intergenic
1184247508 22:43243124-43243146 ATAGCTGTGTGACCTGAACACGG - Intronic
1184630435 22:45774042-45774064 CTGTCTGCAAGACCTGAAGAGGG - Intronic
949256621 3:2055028-2055050 GTGGCTGAGGGCTCTGAAGAAGG - Intergenic
949310984 3:2697867-2697889 AAGACTGAGATCCCTGAAGAAGG - Intronic
949335355 3:2968805-2968827 ATGGCTGAAACACCAGAAGAAGG - Intronic
949377420 3:3405696-3405718 ACAGCTGAGAGACCTGAAGATGG + Intergenic
949440401 3:4073841-4073863 AGGTCTCAAAGACCTGAAGAGGG + Intronic
949474874 3:4433870-4433892 ATGGATAACAGACCTCAAGAAGG + Intronic
949814322 3:8041433-8041455 AAGGCTGAGAGACCCATAGATGG + Intergenic
950592346 3:13947556-13947578 ATGGCTGAGAGCCCCATAGATGG - Intronic
950603491 3:14057475-14057497 ATGGCTGACAGACCCACAGACGG - Intronic
951183853 3:19689094-19689116 ACGGCTGAGAGACCCACAGATGG + Intergenic
951260578 3:20503550-20503572 ATGGCTGGGGCACCTGAAGTTGG - Intergenic
951262166 3:20523303-20523325 ATGGCTGAAAGACCTGAAGATGG - Intergenic
951268396 3:20597293-20597315 ACAGCTAAGACACCTGAAGATGG - Intergenic
951302607 3:21017240-21017262 ATGGCTGAAAGACCTGACGATGG - Intergenic
951867016 3:27319872-27319894 TTGGCTGAGAAAAGTGAAGATGG + Intronic
951967187 3:28399571-28399593 ATGGCTGAGAAACCCAGAGATGG + Intronic
952024145 3:29058067-29058089 ATGGCTGAGAGACCTGAAGATGG + Intergenic
952122776 3:30264398-30264420 ACAGTGGAGAGACCTGAAGATGG + Intergenic
953185349 3:40632112-40632134 ACAGCTGAGAGACCTGAAGATGG + Intergenic
953723896 3:45381243-45381265 ATAGCTGAGAGACCCATAGATGG - Intergenic
953866472 3:46587364-46587386 ATGGCTGAGAGACCCATAGATGG + Intronic
954436775 3:50500472-50500494 CTCGATGAAAGACCTGAAGAAGG + Intronic
954664538 3:52244986-52245008 GTGGTTGAGAGACCGCAAGATGG + Intergenic
955338275 3:58104918-58104940 ATGGGTGAGAGGCCTGCAGGAGG + Intronic
955430148 3:58835098-58835120 ATGGATGAAAGACTGGAAGAAGG - Intronic
955461556 3:59189358-59189380 ATGGTTGAGAGACCTATAAATGG - Intergenic
956865093 3:73361739-73361761 CTGGCTGATAGGCCTGCAGAAGG + Intergenic
956972292 3:74540082-74540104 ATGGCTGCCAGCCCTCAAGAAGG - Intergenic
957517046 3:81268727-81268749 ATGGATGAGATACCTGACAAGGG - Intergenic
957681423 3:83440547-83440569 ACAGCTGGGAGACCTGAAGATGG + Intergenic
957971767 3:87391057-87391079 ATGGCTGAGAGACCCACAGGCGG + Intergenic
958013871 3:87914983-87915005 ATGGCTGAGAGACCCAAGGATGG + Intergenic
958262923 3:91403824-91403846 ATGGTTGAGAGACCCATAGATGG - Intergenic
958775886 3:98482635-98482657 ACAGCTGAGAGACTTGAAGATGG - Intergenic
958819055 3:98951892-98951914 ACAGCTGGGAGACCTGAAGATGG - Intergenic
958969880 3:100600321-100600343 ATGGCTGAGTGACCCATAGATGG - Intergenic
959009677 3:101060910-101060932 ATGGCTGACAGACCTGAACATGG - Intergenic
959039537 3:101405220-101405242 ATGGCTGAGAGACCCATAGATGG + Intronic
959210186 3:103368992-103369014 AAGGCTGAGAGAAGTGAAGAAGG - Intergenic
959361858 3:105403374-105403396 CAGGCTGCGAGACCTGAAAACGG + Intronic
959875225 3:111373969-111373991 ATGGCTGAGAGACCCACAGATGG + Intronic
959899110 3:111639769-111639791 ATGGCTGAGAGACCCATAGATGG + Intronic
959997338 3:112693765-112693787 ATGGCTGAGAGACCCATAGATGG + Intergenic
960026445 3:113016362-113016384 ATGGCAGCCAGAACTGAAGAGGG + Intronic
960064424 3:113354974-113354996 ATGGCTTCAAGACCTGAAGACGG + Intronic
960557322 3:119043697-119043719 ATGGCTGGGAGACCTAAAGATGG + Intronic
960756525 3:121019559-121019581 ATGGCTTAGAGACCTGATAATGG + Intronic
961183510 3:124895131-124895153 AGGACAGAGATACCTGAAGATGG + Intronic
962147354 3:132854899-132854921 ACGGCTGCAAGACCTGAAGATGG - Intergenic
962191928 3:133319667-133319689 ATGTTTGGGAGACCTGAAGATGG + Intronic
962634103 3:137312514-137312536 ATGGATGAGACATCTGAAGGTGG + Intergenic
962709488 3:138073361-138073383 ACGGCTGCAAGACCTGAAGATGG + Intronic
962764620 3:138549852-138549874 ACTGCTGAGAGACATGAAGACGG + Intronic
962983939 3:140517670-140517692 ACGGCCGAGAGAACTGAAGACGG - Intronic
962999410 3:140664231-140664253 ATGGCTGAGAGACCCACAGACGG + Intergenic
963428587 3:145165420-145165442 AAGGCTCAGAGTCCTCAAGATGG + Intergenic
963623039 3:147635660-147635682 ATGGCTGGGAGACCTAAAGATGG + Intergenic
963687870 3:148460817-148460839 ATGGCTGAGAGACCTGAAGATGG - Intergenic
963828097 3:149977237-149977259 AATGCTTAGAGACCTGAAGTGGG - Intronic
964017543 3:151965372-151965394 ATGGCCACAAGACCTGAAGATGG + Intergenic
964160704 3:153641373-153641395 ATGGCTGAGAGACCCACAGATGG + Intergenic
964248581 3:154684075-154684097 ACTGCTGAGAAATCTGAAGATGG - Intergenic
964299417 3:155271389-155271411 ACAGCTGCAAGACCTGAAGATGG + Intergenic
964457616 3:156885617-156885639 ATGGCTGGGAGTCCTGAAGATGG - Intronic
964772658 3:160240151-160240173 AAGGCTGAGAGACCTGAAGATGG + Intronic
964985362 3:162731985-162732007 ATTGCTGAAAACCCTGAAGAAGG - Intergenic
965060972 3:163785934-163785956 ATGGCTGAGAAACCTGAAGAGGG - Intergenic
965132766 3:164723174-164723196 ACAGCTGCAAGACCTGAAGATGG - Intergenic
965296592 3:166955281-166955303 GTGGCTGCAAGACCTGAAGATGG - Intergenic
965321831 3:167261181-167261203 ATGGCTGAGAGACCCATAGATGG - Intronic
965833511 3:172825803-172825825 CTGGCTAAGATAACTGAAGAAGG + Intergenic
966117636 3:176484869-176484891 ATGGCTGAGAGACCCATAGATGG - Intergenic
966122469 3:176537351-176537373 ATGGCTGAGAGGCCTGAAGATGG + Intergenic
966184449 3:177215370-177215392 ATGGCCTAGAGGCCTGAAGTGGG + Intergenic
966734797 3:183179956-183179978 ATGGGTGAGAATCCTGAGGAGGG + Intronic
967079934 3:186040356-186040378 ATGGTTGAGACACTGGAAGAAGG + Intergenic
967105784 3:186254108-186254130 TAGGCTGGGAGAGCTGAAGAGGG + Intronic
967171574 3:186826733-186826755 ATGGGTGAGAATCCTGAAGAGGG - Intergenic
967290337 3:187913675-187913697 CTGGCTGGGACTCCTGAAGAGGG - Intergenic
967559006 3:190896090-190896112 AAGGCTGAGAGACCAATAGATGG + Intergenic
967958629 3:194900532-194900554 ACAGCTGGGAGACCTGAAGATGG - Intergenic
968495377 4:912380-912402 CTGGCTGAGAGCCGTGCAGATGG - Intronic
969130998 4:4991074-4991096 AAGGCTGAGAGCCCTGCAGCAGG + Intergenic
969165581 4:5307977-5307999 ACGGCTGAGAAACCTGAAGATGG - Intronic
970526577 4:16938551-16938573 AGGGCTTTGAGACATGAAGAAGG + Intergenic
970549257 4:17163273-17163295 ATGGCTGAGAGACCCACAGATGG - Intergenic
971050346 4:22855146-22855168 ATGGCTGCAAGACCTGAAGATGG - Intergenic
971528522 4:27654205-27654227 ATGACTGAGAAACCTGAGGGAGG - Intergenic
971576448 4:28280791-28280813 ACGGTTGAGAGAACTGAAGATGG + Intergenic
971582298 4:28357299-28357321 AAGGAAGAGAGACCTGAAGAGGG + Intergenic
971761045 4:30765775-30765797 ATAGCTGAGAGAATTGAAGAAGG + Intronic
971854703 4:32028151-32028173 ATGGGTGAGATACCTCAATATGG + Intergenic
972097265 4:35364097-35364119 ATGGCTGAGAGATCTGACCATGG - Intergenic
972189014 4:36568293-36568315 GTGGCTGAGAGACCCATAGATGG - Intergenic
972806523 4:42533811-42533833 ACAGCTGAGAGACCTGAAGATGG + Intronic
972826848 4:42768432-42768454 ATGGTGGAGAGACCTGAAGATGG + Intergenic
972899713 4:43668589-43668611 GCAGCTGACAGACCTGAAGATGG - Intergenic
973069097 4:45835339-45835361 ATGGCTGAGAGACCCACAGATGG - Intergenic
973342997 4:49025703-49025725 ATGGCCAAGAGATTTGAAGATGG - Intronic
973675986 4:53263600-53263622 ATGGCCGAAAGACCTGAAGATGG - Intronic
973782459 4:54301071-54301093 ATGGCTGAGAGACCCATAGATGG + Intergenic
973787137 4:54342490-54342512 ATGACTGAGAGACCCATAGATGG + Intergenic
973831501 4:54764509-54764531 ATGGCTGAGATACCCACAGACGG - Intergenic
973920165 4:55675962-55675984 ATGGCTGAGATACCTAAAGATGG + Intergenic
974316256 4:60285215-60285237 AAGGCTGAGAGAGATGAAGAAGG + Intergenic
974472155 4:62332078-62332100 ATGGCTGACAGACCTTAAGACGG + Intergenic
974583380 4:63836673-63836695 ACTGCTGAGAGACCTGAAGATGG - Intergenic
974785016 4:66609074-66609096 ATGGCTGAGAGACCTGAAGAGGG - Intergenic
975365148 4:73520636-73520658 ATGGCTGCAAGACCTGAAGATGG - Intergenic
975534650 4:75436223-75436245 ATGGCTGAGAGACCTACAAATGG + Intergenic
975614084 4:76229687-76229709 ACAGCTGGGAAACCTGAAGATGG - Intronic
975814978 4:78208083-78208105 ACAGCTGAGAGACCTACAGACGG + Intronic
975942886 4:79668718-79668740 ATGGTTGCAAGGCCTGAAGATGG + Intergenic
975951086 4:79772129-79772151 ATGGCTGGCAGACTTGAAGATGG + Intergenic
976025747 4:80686314-80686336 AGGGCTTAGAGAGCAGAAGAAGG + Intronic
976465092 4:85358094-85358116 ATGGCTGAGAGACTTGAAGACGG - Intergenic
976562713 4:86520963-86520985 ATGGCTGGGAGAGCTGAAGATGG - Intronic
976686284 4:87819153-87819175 ATGGCTGAGAGACCCATAGATGG - Intergenic
976887910 4:90008184-90008206 ACAGCTGAGAGACTTGAAAATGG + Intergenic
976918211 4:90404653-90404675 AGGTCTGAAAGACCTGAACATGG + Intronic
976963051 4:91003099-91003121 ATGGCTATGAGACCTGCAGATGG - Intronic
977513723 4:97994650-97994672 ATGGCTGAGAGACCTGAAGATGG - Intronic
977635599 4:99294105-99294127 ATGGCCAAGAAACCTGAAGATGG + Intergenic
977733274 4:100380277-100380299 ATGGCTGAGAGACCCATAGATGG + Intergenic
977929848 4:102738390-102738412 ATGGCTAGGAGACCTGAACGTGG + Intronic
978199756 4:106012144-106012166 ATGACTGCAAGACCTGAAGATGG - Intergenic
978201907 4:106032490-106032512 ACAGCTGCAAGACCTGAAGACGG - Intergenic
978726629 4:111977285-111977307 ACAGCTGAGAGACCCGTAGATGG - Intergenic
978761899 4:112361877-112361899 ATGGCTGAGAAGCCTGAAGATGG + Intronic
978924979 4:114231944-114231966 ACGGCTGAGAGACCTGAAGATGG + Intergenic
979159991 4:117447988-117448010 ATGGCTGAGAGACCTGAAGATGG - Intergenic
979357056 4:119716477-119716499 ATGGTTGAAAGACCTGAAGATGG + Intergenic
979499073 4:121418477-121418499 ATGGCTGAGAGACTCACAGATGG - Intergenic
979584773 4:122403342-122403364 ATGGCTGGGAGACCTGAAGATGG - Intronic
979984561 4:127297231-127297253 AAGGCTGAAAGATCTAAAGATGG + Intergenic
979995532 4:127426509-127426531 ATGGCTGAGAGACCCATAGATGG + Intergenic
980153159 4:129073154-129073176 ATGGCTGAGAGACCCACAGATGG - Intronic
980186991 4:129474956-129474978 ACAGCTGGGAGACCTGAAGACGG - Intergenic
980237882 4:130131962-130131984 ATGGCTGAGAGACCCACAGATGG + Intergenic
980246198 4:130246026-130246048 ATGGAGAAGAGACCTCAAGATGG - Intergenic
980392023 4:132159233-132159255 ACAGCTGAGGGACCTGAAGATGG - Intergenic
980409896 4:132403631-132403653 ACAGCTGAGAGACCTAAAGATGG - Intergenic
980488893 4:133499097-133499119 ATGGCTAAGAGACCTGAGGAAGG - Intergenic
980519245 4:133909780-133909802 ATGGCTGAGAGACCTGAAGATGG - Intergenic
980536272 4:134127440-134127462 ATGAATGAGAGACCTGAAGACGG + Intergenic
980761372 4:137238552-137238574 ATGGCTGTCAGACCTGAAGATGG - Intergenic
981346701 4:143684295-143684317 ATGGCTGAGAGACCCATAGATGG + Intronic
981400920 4:144313254-144313276 AAGGCTGAGAGACCAAGAGATGG - Intergenic
981442474 4:144798940-144798962 ATGGCTGAGAGACCTTAAGATGG - Intergenic
981461167 4:145014725-145014747 ATGGCTGAGAGACCCACAGACGG + Intronic
981693699 4:147537875-147537897 GTGGCTGAAAGTCCTGCAGATGG + Intronic
982049941 4:151490297-151490319 ATGGCTAGGATACTTGAAGATGG + Intronic
982189879 4:152843270-152843292 ATGGCTGAGAGACCCACAGATGG - Intronic
982218711 4:153106765-153106787 ATGGCTGAGAGACCCATAGATGG - Intergenic
982312096 4:153997028-153997050 ATGGCTGAGAGACCCATAAATGG - Intergenic
982590849 4:157307895-157307917 ATTCCTGAGAGAGCTGATGAGGG + Intronic
982680085 4:158418737-158418759 ACGGCTGAGAGACCCATAGATGG - Intronic
982696884 4:158612120-158612142 ATGACTGAGATACCTGGAAAAGG - Exonic
982800231 4:159697243-159697265 ATGGCTGAGAGACCTGAAGAAGG - Intergenic
982917714 4:161233528-161233550 ATGGGAGAGAAACCTGAGGAAGG + Intergenic
982960269 4:161827301-161827323 ATGGCTGAGAGACCTGAAGACGG - Intronic
983035924 4:162865452-162865474 ATGGCTGAGAGACCTGAAGATGG + Intergenic
983546964 4:168975256-168975278 ATGGCTGGGAGACCTGAAGGTGG - Intronic
983894487 4:173067780-173067802 CAGGCTGACAGACCTGAAGATGG - Intergenic
983894491 4:173067817-173067839 CCTGCTGACAGACCTGAAGATGG - Intergenic
984066583 4:175055347-175055369 TGGGCTGAGAGACCTAAAGATGG + Intergenic
984527493 4:180875136-180875158 ATGGCTGAGAAACCCATAGACGG - Intergenic
985008554 4:185559586-185559608 GTGGCTGAGAGACCCATAGACGG - Intergenic
985092966 4:186382253-186382275 ATGGCTGAGAGACCCATAGACGG + Intergenic
985326381 4:188775790-188775812 ACGGCTGAGAGACATGAAGATGG - Intergenic
985494087 5:194857-194879 CTGGCTGAGCAGCCTGAAGAAGG - Exonic
985585996 5:734622-734644 ACAGCTGGGAGACCTGAGGACGG + Intronic
985600415 5:826034-826056 ACAGCTGGGAGACCTGAGGACGG + Intronic
985777912 5:1854725-1854747 ATGGCTGAGAGTCCCTAGGAGGG - Intergenic
985957577 5:3276497-3276519 AGGCCTGGGACACCTGAAGATGG - Intergenic
986644527 5:9903690-9903712 ACAGCTGAGAGACCTGAAGATGG - Intergenic
987030347 5:13971626-13971648 ACAGCTGAGAGACCTGAAGATGG - Intergenic
987436839 5:17905577-17905599 ATGGCTGAAAGACTTGAAATTGG - Intergenic
987440553 5:17951377-17951399 ATGGCTGAGTGACCTGAAGATGG - Intergenic
987563630 5:19555912-19555934 ACAGCTGAGAGACCTGAAGATGG + Intronic
987577783 5:19752819-19752841 ATGGCTGAGAGACCCACAGACGG + Intronic
988278457 5:29113826-29113848 ATAGCTTGGAGACCTGAAGATGG - Intergenic
988455295 5:31381983-31382005 GTGGCTGAGAGAAATGGAGACGG + Intergenic
988652321 5:33166432-33166454 ATGATTGAGAGACCTGAAGATGG - Intergenic
988723495 5:33903019-33903041 ACGGTTGAGAGACCTGCAGATGG - Intergenic
989431484 5:41360709-41360731 ATGGCTGAAAGACCTGAAGATGG - Intronic
989533742 5:42539521-42539543 ATGGCTGAGAGACCCATAGATGG - Intronic
989727513 5:44604185-44604207 ACAGCTAAGAGACCTGAAGAAGG + Intergenic
991117439 5:62970349-62970371 ATGGCTGAGAGACCCACAGACGG + Intergenic
991214753 5:64149201-64149223 ACAGCTGGGAGACCTAAAGACGG - Intergenic
991387013 5:66101491-66101513 ATGGCTGAGAGACCCACAGATGG + Intergenic
991414683 5:66379919-66379941 ATGGCTAGGATACCTGAAGATGG + Intergenic
991623050 5:68565988-68566010 ATGGCTGAAAGACCTGAAGACGG + Intergenic
992599788 5:78387809-78387831 ATGGCTGACAGACCTGAAGATGG - Intronic
992972077 5:82071616-82071638 ATGGCTGAGAGAGGTGCACATGG + Intronic
993365980 5:87034879-87034901 ATGGCTGGGAGACATGAAGATGG - Intergenic
993422994 5:87724896-87724918 ATGGCTGAAAGACCTGAGAAGGG + Intergenic
993743065 5:91563421-91563443 GTGCCTGGGAGACCTGAAGGTGG + Intergenic
993883824 5:93394445-93394467 ATGGCTGAGAGGCCCACAGATGG - Intergenic
993920447 5:93794764-93794786 ATAGCTGCAAGACCTGAAGATGG - Intronic
994208153 5:97059268-97059290 ATGGCTGGGAGATATGAAGATGG - Intergenic
994496617 5:100520686-100520708 ATGGCTGCAAGACCTGAAGATGG + Intergenic
994568316 5:101482617-101482639 ATGGCTGAGAGACCCACAGATGG - Intergenic
994822963 5:104677175-104677197 ATGGCTGAGAGACCTGAAGATGG + Intergenic
995374958 5:111463631-111463653 ATGGCTGAGAGACCTGAAGATGG + Intronic
995451082 5:112301500-112301522 ATGGCTGAGAGACATGAAGATGG - Intronic
995694541 5:114865213-114865235 ATGGCTGAGAGACCCACAGATGG - Intergenic
995722565 5:115151672-115151694 ATGGCTGAAAGACCCAAAGATGG + Intronic
995727438 5:115196243-115196265 ATGGCTGAGAGACTTATAGACGG + Intergenic
996010809 5:118479483-118479505 ATGGCTGAGAGACCCATAGAGGG + Intergenic
996141271 5:119912860-119912882 ATGGCTTGGAGACCTAAAGATGG - Intergenic
996197875 5:120632024-120632046 ACAGCTGCAAGACCTGAAGACGG + Intronic
996326922 5:122285972-122285994 ACAGCTGAGAGACCTGAAGATGG - Intergenic
996495247 5:124148266-124148288 ACAGCTGAGAGATCTGAAGGTGG - Intergenic
996616010 5:125441720-125441742 ATAGCTGAGAGACCTGAAGATGG + Intergenic
996631919 5:125643065-125643087 ATGGCTGGGAGACCTGAAGATGG + Intergenic
996694860 5:126383045-126383067 ATGGCTGAGAGACCTGAAGACGG - Intronic
997005036 5:129806460-129806482 ACCGCTGCAAGACCTGAAGAGGG - Intergenic
997231035 5:132243356-132243378 ATGGCTGCAATACCTGAAGATGG - Intronic
997699239 5:135884861-135884883 AAAGCTCAGACACCTGAAGAAGG - Intronic
997758138 5:136419735-136419757 ATGGCTGAGACATCACAAGAAGG + Intergenic
998777421 5:145618533-145618555 ATGGCTGAGAAACCCATAGATGG - Intronic
999337585 5:150735457-150735479 ACAACTGAGAGACCTGAAGACGG + Intronic
999838987 5:155403668-155403690 ATGGCTAAGAGATCTGAAGATGG + Intergenic
1000394708 5:160761337-160761359 ATGGCTGGAAGACCTGAAGATGG + Intronic
1000525589 5:162353567-162353589 ACAGCTGAGAGACCTGAAGATGG - Intergenic
1000565411 5:162841017-162841039 ATGGGGGACAAACCTGAAGAAGG + Intergenic
1000779708 5:165465320-165465342 ATGGCTGAGAGACCTATAGATGG + Intergenic
1001693712 5:173653741-173653763 ACAGCTGAGAGACCTGAAGACGG - Intergenic
1001733698 5:173981127-173981149 ACAGCTGAGAGACTTGAAGATGG - Intronic
1002255411 5:177954716-177954738 ATGGGTGAAAGAAATGAAGAGGG + Intergenic
1002482636 5:179513350-179513372 ATGGGTGAAAGAAATGAAGAGGG - Intergenic
1003297420 6:4844179-4844201 ACAGTTGAGAGACCTGAAGATGG - Intronic
1003743727 6:8975067-8975089 ATGGCTTAAACACCAGAAGAAGG - Intergenic
1004096618 6:12561012-12561034 AAGGCTGGAAGACCTGAAGATGG + Intergenic
1004205080 6:13584990-13585012 AAGGCTGAGAGAAATTAAGACGG + Intronic
1005188727 6:23193437-23193459 AAGGCTGATAGATCGGAAGAAGG - Intergenic
1005305690 6:24512182-24512204 ACGGCTGAGAGACCCACAGATGG - Intronic
1005760328 6:28961562-28961584 AAGGCTGAGAGACCCATAGATGG + Intergenic
1006335136 6:33416540-33416562 AAGGCAGAGAGACCCAAAGACGG + Exonic
1006360480 6:33584467-33584489 ATGGCTGCCAGGCCTGTAGAAGG - Intergenic
1006740500 6:36304748-36304770 ATTGCTCAGGTACCTGAAGATGG - Intronic
1006907176 6:37540529-37540551 ATGGCTGGGAGGCCTCAGGAAGG + Intergenic
1007223929 6:40299760-40299782 AGGGCAGGGAGAGCTGAAGACGG - Intergenic
1007878996 6:45140692-45140714 ATGGCTGGGAGACCTGAAGACGG + Intronic
1008250833 6:49238010-49238032 ATGGCTGGAAGACCTTAAGATGG - Intergenic
1008250849 6:49238092-49238114 ATGGCTGGGAGACTTTAAGATGG - Intergenic
1008290063 6:49704697-49704719 ATGGCTGAGATACCTGAAGATGG - Intronic
1008528555 6:52433528-52433550 ATGGCTGAGAGACCCACAGACGG - Intronic
1008548537 6:52605180-52605202 CTGGCTGAGAGACCAGATGTTGG + Intergenic
1008775344 6:55031678-55031700 ATGGCTGAGAGGCCCATAGATGG - Intergenic
1009360220 6:62802529-62802551 ATGGCTGAGAGACCTGAAGAAGG - Intergenic
1009453236 6:63825533-63825555 ATGGCTGAGAGACCCATAGATGG + Intronic
1009573509 6:65421354-65421376 AAGGCTGAGAGAGGTGAGGAAGG - Intronic
1009644401 6:66378614-66378636 ACAGCTGAGAGACACGAAGATGG + Intergenic
1009800186 6:68527537-68527559 ACAGCTGAGAGACCTGAAGGTGG - Intergenic
1009968889 6:70605288-70605310 ATGGCTGAGAGACCCATAGACGG + Intergenic
1010008896 6:71027889-71027911 ACGGCTGAGAGACCAACAGACGG - Intergenic
1010438179 6:75859968-75859990 GAAGCAGAGAGACCTGAAGAAGG - Intronic
1010479853 6:76338028-76338050 ACTGCTGAGAGACCTGAAGATGG - Intergenic
1010518404 6:76802890-76802912 ATGGCTGCAAGAACTGAAGATGG - Intergenic
1010862979 6:80937119-80937141 ACAACTGAGAGACCTGAAGATGG - Intergenic
1010975981 6:82313845-82313867 ATGGCTGGGAGACCTGAAGATGG + Intergenic
1010991197 6:82482225-82482247 AAGGATGAGAGAGATGAAGAAGG - Intergenic
1011156570 6:84340483-84340505 ACGGCTGGGAGACCTTAAGATGG - Intergenic
1011233384 6:85188264-85188286 ATGGCTGAGAGACCCATGGATGG + Intergenic
1011366065 6:86584226-86584248 ATGGTTGACAGACCTGAAGACGG - Intergenic
1011375462 6:86681819-86681841 ATGGCTGAGAGACCTGAAGATGG - Intergenic
1011589023 6:88952754-88952776 ATGGCTGGGACACCTGAAGATGG + Intronic
1011893243 6:92193760-92193782 ACAGCTGAGAGACCCAAAGACGG - Intergenic
1012208306 6:96489100-96489122 ATGACTGAGAGACCCATAGATGG - Intergenic
1012225137 6:96694699-96694721 ACGGCTGAGAGACCCACAGATGG + Intergenic
1012299172 6:97563363-97563385 ATGGCTGCAAGATCTGAAGATGG - Intergenic
1012581224 6:100872677-100872699 ATGACTGAGAGACCCACAGACGG + Intronic
1013613433 6:111818210-111818232 AAGGCTGAGAGAAACGAAGAGGG + Intronic
1013780022 6:113718843-113718865 CTGCCTGATAGGCCTGAAGATGG + Intergenic
1013852577 6:114534294-114534316 ATGGCTGAGAGACCCATAGATGG - Intergenic
1013946382 6:115727934-115727956 ACTGCTGAGAGATCTGAAGATGG - Intergenic
1014336894 6:120147805-120147827 ATGACTGAGAGACCTATAGATGG + Intergenic
1014420231 6:121235060-121235082 ATAGCTGCAAGACCTGAAGACGG - Intronic
1014481976 6:121950619-121950641 ATAGCTGCAAGACCTAAAGACGG - Intergenic
1014566624 6:122956715-122956737 ACAGCTGAGAGACCTGAAGATGG + Intergenic
1014581453 6:123142388-123142410 ATGACTGGGAGACCTGAATATGG + Intergenic
1014603957 6:123448860-123448882 GTGGCTGAGAGACCCACAGATGG + Intronic
1014722983 6:124940566-124940588 AAGGCTCAGAGACATGAAGATGG + Intergenic
1014792709 6:125692983-125693005 ATGGCTGTGAGACCCGAATATGG - Intergenic
1014795986 6:125724850-125724872 ATGGGGGAGAGACCTCAAAAAGG + Intergenic
1014851981 6:126351821-126351843 ATGGGTATGAGACCTTAAGATGG + Intergenic
1015347887 6:132180684-132180706 ACGGCTGAGAGACCCAAAGATGG + Intergenic
1015644153 6:135368192-135368214 ATGGCTGAGAGACCTGAAGACGG - Intronic
1015786587 6:136924562-136924584 GTGGCTGGGAGCTCTGAAGAAGG + Exonic
1015899928 6:138053755-138053777 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1015958303 6:138621136-138621158 TTAGTTGAGAAACCTGAAGACGG + Intronic
1016175999 6:141078134-141078156 GTGGCTGACAGACCTGAAGATGG + Intergenic
1017326356 6:153145633-153145655 ATGGCTGCAAGACCTGAAGATGG - Intergenic
1017718218 6:157226880-157226902 AGGGCTGGGAGACCTGAACCGGG - Intergenic
1017848826 6:158284708-158284730 TTGACTGAGAGCCCTGAAGTGGG - Intronic
1018336956 6:162802650-162802672 ATGGGTGAGAAATATGAAGAAGG - Intronic
1018596793 6:165489236-165489258 ACAGCTGAAAGACCTAAAGATGG + Intronic
1018755346 6:166843559-166843581 ACAGCTGAAAGACGTGAAGACGG + Intronic
1018781713 6:167073863-167073885 ATGGCTGGGGGACCTGAAGATGG - Intergenic
1018915111 6:168128298-168128320 GTGTCTGAGAGCCCGGAAGAAGG + Intergenic
1019123403 6:169823578-169823600 ACAGCTGAGAAACCTGAAGACGG - Intergenic
1019896281 7:3985938-3985960 ATGTCTGAGAGACCAAAAGCTGG + Intronic
1020332293 7:7032156-7032178 ATGAATGGGAGACCTGAAGATGG - Intergenic
1020373759 7:7462017-7462039 ATGGCTGAGGGACCCACAGACGG + Intronic
1020634960 7:10685335-10685357 ATGGCTGAGAGACCCATAGAAGG + Intergenic
1020860844 7:13489872-13489894 ATGGCTGAGAAACCCATAGATGG + Intergenic
1022030859 7:26490902-26490924 ATGGCTCAGAGAGGTGGAGAAGG - Intergenic
1022894807 7:34739757-34739779 ATGGCTGAGAGACCCACAGATGG - Intronic
1023255181 7:38305997-38306019 ATGGGTGGGATACCTGGAGAGGG - Intergenic
1023537681 7:41231098-41231120 ATGGCTGCAAGACCTGAAGACGG - Intergenic
1023669709 7:42562416-42562438 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1023692567 7:42806196-42806218 ACAGCTAACAGACCTGAAGATGG + Intergenic
1023748915 7:43351217-43351239 ATGGCTGAGAGACCTATAGATGG - Intronic
1024174813 7:46828052-46828074 ACTGCAGAGAGACCTAAAGATGG + Intergenic
1024367243 7:48535360-48535382 ACGGCTGAAAGACCTGAAGATGG - Intronic
1026854263 7:73742828-73742850 CTGGCTGAGTGACCTGGAGCTGG - Intergenic
1027328977 7:77071337-77071359 ATGGCTGAGAGACCCATAGACGG - Intergenic
1027350393 7:77306055-77306077 AGGGCTGAGAGACCCATAGATGG - Intronic
1027417591 7:77989912-77989934 ATGGCTGAAAGACCCATAGATGG - Intergenic
1027687717 7:81297873-81297895 ATGGCAGGCAGACTTGAAGATGG - Intergenic
1027733244 7:81902598-81902620 ACGGCTGGGAGACCTGAAGATGG - Intergenic
1028182895 7:87747326-87747348 ACGGCTGAGAGACCCATAGATGG - Intronic
1028197811 7:87927251-87927273 ATGGCTGCAAGACCTGAAGCTGG + Intergenic
1028250871 7:88539149-88539171 ATGGCTGCAAGACCTGAAGATGG - Intergenic
1028261742 7:88674548-88674570 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1028347997 7:89807564-89807586 ATGGCTTGGAGACCAGAAGATGG - Intergenic
1028529579 7:91824278-91824300 AGGGCTGAGAAAACTGAAGATGG - Intronic
1028782935 7:94757710-94757732 ATGGATGAGAGACCTGAAGATGG + Intergenic
1028818349 7:95176143-95176165 ATGGCTGAGAGACCCATAGATGG + Intronic
1028819540 7:95190375-95190397 ATGGCTGGGAGACCTGAAGAAGG - Intronic
1028962177 7:96761506-96761528 ATGGCTGAGAGACCCACAGATGG - Intergenic
1028993514 7:97075644-97075666 ACAGCTGAGAGACCCGTAGATGG - Intergenic
1029538130 7:101167572-101167594 ATGGCTCAGACATCTGGAGAGGG + Intergenic
1029786794 7:102800041-102800063 ATGGCTGAGAGACCCATAGACGG + Intronic
1030455858 7:109772947-109772969 ATGGCTGAGAGACCTGAAAATGG + Intergenic
1030936055 7:115585690-115585712 ACAGCTGAGAGACCCGTAGAAGG + Intergenic
1030972388 7:116076062-116076084 ACGGCTGAAAGACCTCAAGATGG + Intronic
1031057369 7:117007558-117007580 CTAGCTGAGATACCTGATGAAGG + Intronic
1031138925 7:117919549-117919571 ATGGCTGAGAAACCCACAGATGG + Intergenic
1031147868 7:118016966-118016988 ATGGCTGCGAGACCTGCAGATGG + Intergenic
1031169392 7:118273326-118273348 ACGGCTGAGAGACCCATAGATGG - Intergenic
1031576720 7:123423132-123423154 ACAGCTGAGAGACCTGAAGATGG + Intergenic
1031612694 7:123846002-123846024 ATGGCTGAGAGACCTGCAGATGG - Intronic
1031879281 7:127177638-127177660 ATGGCTGAGAGACCCATAGATGG + Intronic
1031960395 7:127984240-127984262 ATGTCAGAGAGACCTGAGGCTGG - Intronic
1031962716 7:128004361-128004383 AGTGCTGTGTGACCTGAAGAGGG + Intronic
1032448856 7:132009539-132009561 GTGGCTGAAAGACCTGAAGATGG - Intergenic
1032935764 7:136729590-136729612 ATGGCTGAAAAACCTGAAGATGG + Intergenic
1033026903 7:137782780-137782802 ACAGCTGAAAGACCTGAAGATGG + Intronic
1033401179 7:141026764-141026786 ACAGCTGGGAGACTTGAAGATGG - Intergenic
1033462692 7:141562013-141562035 ATGGCTGAGAGACCTGAATATGG - Intronic
1033622959 7:143078339-143078361 ATGGCTGAGAGACCTAAAGATGG + Intergenic
1033816653 7:145082276-145082298 ATGGCTGAGAGACCTGAAGATGG - Intergenic
1033961521 7:146919537-146919559 ATGGCTGAAAGACCCGAAGATGG - Intronic
1034019567 7:147626958-147626980 ATGATTGAGAGACCTGAAGATGG + Intronic
1034247812 7:149662288-149662310 GCAGCTGGGAGACCTGAAGATGG - Intergenic
1034410874 7:150941511-150941533 CCGGCTGAGAAACCTGCAGAAGG + Intergenic
1035151281 7:156874587-156874609 ACAGCTGAGAGACCTGCAGACGG + Intronic
1035327314 7:158073466-158073488 ATAGCTTTGAGACCTGAAGGAGG - Intronic
1035724817 8:1817843-1817865 GAGGCTGAGAGGCCTGAAGGGGG + Intergenic
1036095352 8:5718168-5718190 CTGGCTGAGAGAAGTGAAGGAGG + Intergenic
1038367145 8:26948097-26948119 ATGGCTGAGAGACCCATAGATGG - Intergenic
1038908812 8:31938198-31938220 ACAGCTGCAAGACCTGAAGAGGG + Intronic
1039000935 8:32979582-32979604 ATGGGTGAGAGACCTGAAGATGG - Intergenic
1039145074 8:34438167-34438189 ATGGCTGAGAGACTTAAAAATGG + Intergenic
1039571894 8:38593345-38593367 ATGGCTGAGAGACCCACAGATGG + Intergenic
1039642433 8:39238217-39238239 ATGGCTGAGAGACCTAAAGATGG + Intronic
1040442799 8:47462266-47462288 TTGGCAGAGAAACCTCAAGACGG - Intronic
1040529297 8:48253448-48253470 GTGGCTGAGAGACCTGAAGATGG - Intergenic
1041150393 8:54926250-54926272 ATGACTGAGAGACCTGAAGATGG + Intergenic
1041175581 8:55193343-55193365 GTGGCGGAGAGACCTGGGGAGGG - Intronic
1041208462 8:55522817-55522839 ATGGGTGTGAGACCTGGAAATGG - Intronic
1041227829 8:55717488-55717510 ATGGCCGAGAGACCCATAGATGG + Intronic
1041570482 8:59332766-59332788 ATGGCTGAGAGACCCATAGGTGG - Intergenic
1041582254 8:59474759-59474781 TTGGCTAAGAAGCCTGAAGATGG + Intergenic
1041637172 8:60156833-60156855 ATGACTGAGAGACCCATAGATGG + Intergenic
1041763591 8:61393757-61393779 ATGGCTGGGAGTCCTGAAAATGG - Intronic
1041877925 8:62712090-62712112 ATGGCTGAGAAACCCATAGATGG - Intronic
1042160636 8:65890741-65890763 ACAGCTGAAAGACCTGAGGATGG + Intergenic
1043024594 8:75049972-75049994 AGAGCTGAGAGCCCTGAACAGGG - Intergenic
1043040848 8:75259969-75259991 ATGGCTGAGAGAACCACAGATGG + Intergenic
1043104334 8:76089379-76089401 AGGGCTGGGAGACCTGAAGATGG - Intergenic
1043270761 8:78330054-78330076 ATGGCTGAGAGATCCATAGATGG + Intergenic
1043616437 8:82130756-82130778 GTGGCTGGGAGACCTGAAGATGG + Intergenic
1043987871 8:86715334-86715356 ATGGCTGAGAGACCTGAAGACGG + Intronic
1044242251 8:89901931-89901953 GTGTTTGAGAGACATGAAGAGGG + Intronic
1044947825 8:97407712-97407734 ATGGCTTCAAGACCTGAAGATGG - Intergenic
1045257262 8:100536898-100536920 CTGCCTGAGAGACTTGAAGATGG + Intronic
1045671109 8:104553919-104553941 ATAGCTGAGAGACCTGAAGATGG + Intronic
1045685310 8:104705355-104705377 AGGGCTGAGGGAAGTGAAGATGG - Intronic
1045952252 8:107865383-107865405 ATGGTTGAAAGACCTGAAGATGG - Intergenic
1046033829 8:108817085-108817107 ATGGGTGTGGGACCTGAAGATGG - Intergenic
1046074470 8:109299892-109299914 ATGGCTGAGAGACCCACAAATGG + Intronic
1046394667 8:113625905-113625927 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1047167854 8:122460408-122460430 TTGGCTTAAAGACCTGAAAATGG + Intergenic
1047227263 8:122967500-122967522 AAGACTGGGAGACCTGAAGATGG - Intronic
1047341020 8:123980716-123980738 AAGGCTGACAAAACTGAAGATGG + Exonic
1047592073 8:126336975-126336997 ATGGCTGGGAAACCTGAAGATGG + Intergenic
1048440016 8:134452923-134452945 ATGACTGGGTGACCTGAGGAGGG + Intergenic
1048861715 8:138728726-138728748 ATGGCTGTGTGACCTAAAGTGGG - Intronic
1049350587 8:142162436-142162458 ATGGATGAAAGAGATGAAGATGG + Intergenic
1049702564 8:144021784-144021806 AGGGGAGAGAGACCTGAAGTGGG - Intronic
1049702618 8:144022010-144022032 AGGGGAGAGAGACCTGAAGTGGG - Intronic
1049702664 8:144022186-144022208 AGGGGAGAGAGACCTGAAGTGGG - Intronic
1049702770 8:144022631-144022653 AGGGGAGAGAGACCTGAAGTGGG - Intronic
1050133548 9:2438890-2438912 ACAGCTAAGAGACCTGAAGATGG - Intergenic
1050143232 9:2538506-2538528 GTGGATGACAGAACTGAAGATGG - Intergenic
1050502747 9:6315594-6315616 ATGGCTGAGAGACCCATAGATGG + Intergenic
1050899040 9:10921666-10921688 AAGGCAAAGAAACCTGAAGAGGG + Intergenic
1050903525 9:10975126-10975148 CTGGTTGGAAGACCTGAAGATGG + Intergenic
1051362740 9:16295204-16295226 ATGACTGAGAGACCCATAGACGG + Intergenic
1051777760 9:20655050-20655072 AAGGCTGAGACACATGAGGAAGG - Intergenic
1051881233 9:21841567-21841589 ACAGCTTGGAGACCTGAAGATGG + Intronic
1051929521 9:22367756-22367778 CAGGCTGAAAGACCTGAAGATGG + Intergenic
1052006598 9:23357288-23357310 ATGGCTGACAGATCAGAAGATGG - Intergenic
1052218392 9:25992990-25993012 AAGGCTGAGAGACCTGAAGATGG + Intergenic
1052253679 9:26428107-26428129 ATGGCTACAAGACCTGAAGATGG + Intergenic
1052624847 9:30962082-30962104 ATGGCTGAGAGACACACAGAGGG - Intergenic
1052731397 9:32290910-32290932 ATGACTGAGAGACCCATAGATGG - Intergenic
1053247709 9:36548559-36548581 ATGGCTGAGAGACCTACAGATGG + Intergenic
1054867730 9:70020093-70020115 ATGGCTGAGAGACCCACAGACGG - Intergenic
1054938885 9:70718159-70718181 ATGACCAAGAGATCTGAAGACGG + Intronic
1054940576 9:70736152-70736174 ATGACCAAGAGATCTGAAGACGG + Intronic
1055125948 9:72718555-72718577 ACAGCTGAGAGACCTAAAGATGG - Intronic
1055244326 9:74221276-74221298 ATGGCTGAGAGACTTGAAGATGG + Intergenic
1056026718 9:82505086-82505108 ATGGCTGGGAGAACTGAAGATGG + Intergenic
1056404050 9:86257466-86257488 ACAGCTGAGAGAACTGAAAAAGG - Intronic
1056696275 9:88856687-88856709 ATAGCTGAGAGAGCTAAAGATGG + Intergenic
1056948127 9:91018102-91018124 ATGACTGAGAGACCTGAAGATGG + Intergenic
1057119437 9:92558491-92558513 ACGGCTGAGAGACCCATAGATGG - Intronic
1057475782 9:95399789-95399811 ATGGCTGACAGGCCTGAAGATGG + Intergenic
1058233660 9:102462057-102462079 ACGGCTGCAAGATCTGAAGATGG + Intergenic
1058261089 9:102832982-102833004 ATGTTTGGGAAACCTGAAGAGGG - Intergenic
1058540641 9:106009012-106009034 ATGGCTGAGAGACTGACAGATGG - Intergenic
1058554819 9:106155852-106155874 ATGGCTAGGAGACCTGAAAAGGG + Intergenic
1058685931 9:107479637-107479659 CTTGCTGAGAGACCAGGAGATGG - Intergenic
1058758061 9:108102182-108102204 AAGGCAGAGAGACATGGAGAAGG + Intergenic
1059808117 9:117826682-117826704 ATGGCTGAGAGAATAGAACAAGG + Intergenic
1059827658 9:118049952-118049974 ATGGCTGAGAGACCTGAAGATGG - Intergenic
1060043729 9:120324015-120324037 CTGGCTGTGGGACCTGGAGATGG - Intergenic
1060311123 9:122463776-122463798 GTGGCGGAGAGACCTGAAGAGGG - Intergenic
1060596974 9:124854272-124854294 ATGGCTGGGAGACCCGGAGTGGG + Exonic
1062109222 9:134772956-134772978 TTGGCGGAGACACCTGAGGAAGG - Intronic
1062164912 9:135102818-135102840 AGGGCTGAGTGCCCTGAAGCAGG - Intronic
1186906499 X:14116779-14116801 ATGGGTGAGAGATATAAAGATGG + Intergenic
1188719082 X:33500616-33500638 ATGGCTTGGAGGCCTGAGGATGG + Intergenic
1189600084 X:42615172-42615194 ACAGCTGAGAGACCTGAAGATGG - Intergenic
1189603236 X:42649120-42649142 ACGGCTGAGAGACCTATAGACGG + Intergenic
1189711295 X:43815098-43815120 ATGGCTGATACAGCTGAAAATGG - Intronic
1190067884 X:47254922-47254944 ATGGCTCACAGAACTCAAGAAGG + Intergenic
1190375968 X:49788578-49788600 ACAGCTCAGAGACCTGCAGACGG - Intergenic
1190897247 X:54633097-54633119 GTGGCTAAGAGACCCGAAGATGG - Intergenic
1191018825 X:55839469-55839491 ACAACTGAGAGACCTGAAGATGG - Intergenic
1191045399 X:56130291-56130313 GAGACTGAGAGAACTGAAGATGG + Intergenic
1191084615 X:56550985-56551007 AGGGAGGAGAGAGCTGAAGAAGG - Intergenic
1191100350 X:56719729-56719751 ACAGCTAAGAGAACTGAAGATGG + Intergenic
1191148726 X:57197727-57197749 ATGGCCAAGAGACCTGTAAATGG - Intergenic
1191640355 X:63424805-63424827 ATGGCTGAGACATCTGGATATGG - Intergenic
1191779822 X:64853658-64853680 ATGGTTGAGAGACCCATAGATGG - Intergenic
1191784467 X:64903056-64903078 ATGGCTGGGAGACCTGAAGATGG - Intergenic
1191879388 X:65829145-65829167 ACAACTGAGAAACCTGAAGATGG + Intergenic
1191903512 X:66064048-66064070 ATGGCTGAGAGACCCATAGATGG - Intergenic
1191917291 X:66216376-66216398 ATGGCTGAGAGACATGAAGACGG + Intronic
1192014561 X:67315639-67315661 ATGGGTGAGAGACCCATAGATGG - Intergenic
1192297245 X:69864241-69864263 ACAGCTGCAAGACCTGAAGATGG + Intronic
1192688626 X:73334783-73334805 ATGGCTGAGGGATCTGAAGATGG - Intergenic
1192895573 X:75440019-75440041 ATGACTGAGAGAACTGAAGATGG - Intronic
1192900109 X:75487319-75487341 ATGACTGGGAGACCTGAAGATGG + Intronic
1192921563 X:75712807-75712829 ACAACTGAGAGACCTGAAGGTGG - Intergenic
1192929639 X:75792200-75792222 ATGGCTGAGAGACCCACAGATGG + Intergenic
1192944968 X:75956811-75956833 ACAGCTGAGAAACCTGAAGATGG - Intergenic
1192950933 X:76015122-76015144 ATGGCTGAGAGACCTGAATATGG + Intergenic
1193076627 X:77362632-77362654 ACAGCTGGGAGACCTGAAGATGG - Intergenic
1193078026 X:77375678-77375700 ATGGCTGAGAGACTGGAAGATGG + Intergenic
1193253341 X:79319160-79319182 ATAGCTGAGAGACCCATAGATGG - Intergenic
1193366336 X:80638153-80638175 ATGGCTGCAAGACCTGAAGATGG + Intergenic
1193382713 X:80834422-80834444 ATGGCTAGGAGACCTAAAGATGG + Intergenic
1193404312 X:81082952-81082974 ATGGCTGAGAGACCTGCAGAGGG + Intergenic
1193420871 X:81280459-81280481 ATGGCTGAGAGACCCATAGATGG + Intronic
1193541169 X:82774784-82774806 ATGGCTGAGAGACTAGAAGACGG - Intergenic
1193556574 X:82961115-82961137 CTAGCTGGGAGACCTGAAGATGG + Intergenic
1193578579 X:83233137-83233159 AAGGCTGAGAGACCCATAGATGG + Intergenic
1193631919 X:83899780-83899802 GTGGCTGAGAGATCTGAAGATGG + Intergenic
1193785950 X:85760184-85760206 ATAGCTGAGAGACCAACAGATGG - Intergenic
1193817482 X:86121781-86121803 ACAGCTTAGAGACCTGAAGATGG - Intergenic
1193937176 X:87637134-87637156 ATGGCTGAGAGACCTGAAGATGG + Intronic
1193994863 X:88352950-88352972 ATGGCTGCAAGACCTGAAGATGG + Intergenic
1194081057 X:89465722-89465744 ATGGTTGGGAGACCTGAAGATGG + Intergenic
1194095262 X:89631895-89631917 AAGGTTGAGAGACCTGAAGATGG - Intergenic
1194104434 X:89751601-89751623 ATGGCTGAGAAACCTGAAGATGG - Intergenic
1194165412 X:90508449-90508471 ATGGCTGAGAGACCTGAAGAAGG + Intergenic
1194168170 X:90548316-90548338 GTGGCTGAGAGATCTGAAGATGG + Intergenic
1194191908 X:90848085-90848107 ACGGCTGGGAGACTTGAAGACGG - Intergenic
1194313970 X:92350557-92350579 ACAGCTAAGAGACGTGAAGACGG - Intronic
1194314118 X:92352817-92352839 ACAGCTGAGAGACCTGAAGATGG - Intronic
1194547582 X:95257069-95257091 ATGGCTGAGAGACCTGCAGATGG - Intergenic
1194602617 X:95940876-95940898 AAGGCTGCGAGACGTGAAGATGG + Intergenic
1195054877 X:101134699-101134721 AAGGCTGATAAACCTGAAAAAGG + Intronic
1195231912 X:102859099-102859121 ACAGCTGAGAGACCTGCAGATGG - Intergenic
1195237154 X:102911644-102911666 CTGGCTGCAAAACCTGAAGATGG + Intergenic
1195253272 X:103068653-103068675 AAGGTTGAGAGAGGTGAAGAAGG + Intergenic
1195708107 X:107752704-107752726 ATGGATGAGAGCCCTAAAGATGG + Intronic
1195972761 X:110491614-110491636 ATGGCTGCAAGACCTGAAGATGG - Intergenic
1196170953 X:112587899-112587921 ATGGCTGAGATACCCATAGATGG + Intergenic
1196177470 X:112655597-112655619 ATGGTTCAGAGAGATGAAGAAGG - Intronic
1196218962 X:113088696-113088718 ATGGCTGACAGACCCATAGATGG + Intergenic
1196590428 X:117481195-117481217 ACGGCTGAGAGACCCATAGATGG - Intergenic
1196675685 X:118418534-118418556 ACGGCTGAGAGACCCATAGACGG - Intronic
1196948215 X:120849941-120849963 ATGGCTGAGAGACCCACAGATGG - Intergenic
1196949062 X:120857670-120857692 ATGGCTGCAAGACCTGAAGATGG + Intergenic
1197034593 X:121858984-121859006 ACGGCTGCAAGACCTGAAGATGG - Intergenic
1197055433 X:122113446-122113468 ATGGCTGAGAGACCCGAAGATGG - Intergenic
1197066176 X:122236950-122236972 ATGGCTGAGAGACCCATAGATGG - Intergenic
1197083587 X:122446812-122446834 ACACCTGAGAGACCTGAAGATGG + Intergenic
1197102533 X:122673298-122673320 ATGGCTGAGACACCCATAGATGG + Intergenic
1197132468 X:123020459-123020481 ATGGCTGAGAGACCCATAGATGG + Intergenic
1197184463 X:123570809-123570831 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1197472115 X:126877040-126877062 ATGTCTTGGAGACCTAAAGATGG - Intergenic
1197572100 X:128162828-128162850 ATGGCTGAGACACCTGAAAATGG - Intergenic
1197953753 X:131924169-131924191 CTGGCTGAGAGACCCATAGATGG + Intergenic
1198150302 X:133901924-133901946 CTGGCTGTGTGACCTGAAGCAGG + Intronic
1198243477 X:134807269-134807291 AGGGCTGAGAGAGATGGAGAAGG + Exonic
1198559851 X:137837865-137837887 ATGGCTACAAGACCTGAAGATGG - Intergenic
1198582949 X:138087042-138087064 ATGACTGAGAGACCCACAGATGG + Intergenic
1198797221 X:140410287-140410309 ATGGCTGAGAGACCTGAAGATGG - Intergenic
1198943226 X:141981891-141981913 CATGCTTAGAGACCTGAAGATGG - Intergenic
1199014896 X:142804083-142804105 GTGGCTAAAAGACCTGAAGATGG - Intergenic
1199553624 X:149081991-149082013 ACAGCTGAGAGACCTGAAGATGG + Intergenic
1199851585 X:151727811-151727833 AAGCCTGAGAGGCCTGAAGTGGG - Intergenic
1200332740 X:155314372-155314394 ATGGCCAAAAGACATGAAGATGG + Intronic
1200433731 Y:3121923-3121945 ATGGTTGGGAGACCTGAAGATGG + Intergenic
1200447893 Y:3288073-3288095 AAGGTTGAGAGACCTGAAGATGG - Intergenic
1200456392 Y:3399383-3399405 ATGGCTGAGAAACCTGAAGATGG - Intergenic
1200511680 Y:4086259-4086281 ATGGCTGAGAGACCTGAAGATGG + Intergenic
1200514416 Y:4126099-4126121 GTGGCTGAGAGATCTGAAGATGG + Intergenic
1200538547 Y:4430520-4430542 ACAGCTGGGAGACTTGAAGACGG - Intergenic
1200622237 Y:5464659-5464681 ACAGCTGAGAGACCTGAAGATGG - Intronic
1201306752 Y:12556949-12556971 ATGGCTGGGAGACCCATAGATGG + Intergenic
1201315855 Y:12644498-12644520 ATGGCTGAGAGAACCATAGATGG + Intergenic
1201934657 Y:19395628-19395650 ATGGCTAAGAGACCTGAATATGG - Intergenic