ID: 974785017

View in Genome Browser
Species Human (GRCh38)
Location 4:66609075-66609097
Sequence CATGGCTGAGAGACCTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974785017_974785029 22 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785029 4:66609120-66609142 GAGGTGGCTGGGGAGGTAAAGGG No data
974785017_974785024 10 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data
974785017_974785021 3 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785021 4:66609101-66609123 ACCAACACTTTCTCTGATGGAGG No data
974785017_974785020 0 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785020 4:66609098-66609120 GATACCAACACTTTCTCTGATGG No data
974785017_974785023 6 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785023 4:66609104-66609126 AACACTTTCTCTGATGGAGGTGG No data
974785017_974785025 11 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785025 4:66609109-66609131 TTTCTCTGATGGAGGTGGCTGGG No data
974785017_974785026 12 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785026 4:66609110-66609132 TTCTCTGATGGAGGTGGCTGGGG No data
974785017_974785027 15 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785027 4:66609113-66609135 TCTGATGGAGGTGGCTGGGGAGG No data
974785017_974785028 21 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785028 4:66609119-66609141 GGAGGTGGCTGGGGAGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974785017 Original CRISPR CATGGCTGAGAGACCTGAAG AGG (reversed) Intergenic
No off target data available for this crispr