ID: 974785019

View in Genome Browser
Species Human (GRCh38)
Location 4:66609093-66609115
Sequence AGAGAAAGTGTTGGTATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974785019_974785026 -6 Left 974785019 4:66609093-66609115 CCATGGATACCAACACTTTCTCT No data
Right 974785026 4:66609110-66609132 TTCTCTGATGGAGGTGGCTGGGG No data
974785019_974785025 -7 Left 974785019 4:66609093-66609115 CCATGGATACCAACACTTTCTCT No data
Right 974785025 4:66609109-66609131 TTTCTCTGATGGAGGTGGCTGGG No data
974785019_974785028 3 Left 974785019 4:66609093-66609115 CCATGGATACCAACACTTTCTCT No data
Right 974785028 4:66609119-66609141 GGAGGTGGCTGGGGAGGTAAAGG No data
974785019_974785024 -8 Left 974785019 4:66609093-66609115 CCATGGATACCAACACTTTCTCT No data
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data
974785019_974785029 4 Left 974785019 4:66609093-66609115 CCATGGATACCAACACTTTCTCT No data
Right 974785029 4:66609120-66609142 GAGGTGGCTGGGGAGGTAAAGGG No data
974785019_974785027 -3 Left 974785019 4:66609093-66609115 CCATGGATACCAACACTTTCTCT No data
Right 974785027 4:66609113-66609135 TCTGATGGAGGTGGCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974785019 Original CRISPR AGAGAAAGTGTTGGTATCCA TGG (reversed) Intergenic
No off target data available for this crispr