ID: 974785022

View in Genome Browser
Species Human (GRCh38)
Location 4:66609102-66609124
Sequence ACCTCCATCAGAGAAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974785022_974785028 -6 Left 974785022 4:66609102-66609124 CCAACACTTTCTCTGATGGAGGT No data
Right 974785028 4:66609119-66609141 GGAGGTGGCTGGGGAGGTAAAGG No data
974785022_974785029 -5 Left 974785022 4:66609102-66609124 CCAACACTTTCTCTGATGGAGGT No data
Right 974785029 4:66609120-66609142 GAGGTGGCTGGGGAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974785022 Original CRISPR ACCTCCATCAGAGAAAGTGT TGG (reversed) Intergenic
No off target data available for this crispr