ID: 974785024

View in Genome Browser
Species Human (GRCh38)
Location 4:66609108-66609130
Sequence CTTTCTCTGATGGAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974785017_974785024 10 Left 974785017 4:66609075-66609097 CCTCTTCAGGTCTCTCAGCCATG No data
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data
974785016_974785024 11 Left 974785016 4:66609074-66609096 CCCTCTTCAGGTCTCTCAGCCAT 0: 43
1: 72
2: 126
3: 260
4: 467
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data
974785014_974785024 25 Left 974785014 4:66609060-66609082 CCTTGTGATGCGGACCCTCTTCA No data
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data
974785019_974785024 -8 Left 974785019 4:66609093-66609115 CCATGGATACCAACACTTTCTCT No data
Right 974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974785024 Original CRISPR CTTTCTCTGATGGAGGTGGC TGG Intergenic
No off target data available for this crispr