ID: 974786996

View in Genome Browser
Species Human (GRCh38)
Location 4:66631344-66631366
Sequence CAACATTCATAGTCTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974786996_974787000 -10 Left 974786996 4:66631344-66631366 CCCTGCACAGACTATGAATGTTG No data
Right 974787000 4:66631357-66631379 ATGAATGTTGGTCATTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974786996 Original CRISPR CAACATTCATAGTCTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr