ID: 974792095

View in Genome Browser
Species Human (GRCh38)
Location 4:66705285-66705307
Sequence CATTTGGCACAGAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974792095_974792103 18 Left 974792095 4:66705285-66705307 CCCAGCTCCTTCTGTGCCAAATG No data
Right 974792103 4:66705326-66705348 TTTCACCAACACCACCACTCTGG No data
974792095_974792101 -8 Left 974792095 4:66705285-66705307 CCCAGCTCCTTCTGTGCCAAATG No data
Right 974792101 4:66705300-66705322 GCCAAATGGTATAGGCTGGTTGG No data
974792095_974792106 27 Left 974792095 4:66705285-66705307 CCCAGCTCCTTCTGTGCCAAATG No data
Right 974792106 4:66705335-66705357 CACCACCACTCTGGTGGTCCTGG No data
974792095_974792104 21 Left 974792095 4:66705285-66705307 CCCAGCTCCTTCTGTGCCAAATG No data
Right 974792104 4:66705329-66705351 CACCAACACCACCACTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974792095 Original CRISPR CATTTGGCACAGAAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr