ID: 974793947

View in Genome Browser
Species Human (GRCh38)
Location 4:66724615-66724637
Sequence TATCCACGGCTGCTAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974793942_974793947 5 Left 974793942 4:66724587-66724609 CCATGCCAAAAGGTTATTCCTTT No data
Right 974793947 4:66724615-66724637 TATCCACGGCTGCTAAAAAGTGG No data
974793943_974793947 0 Left 974793943 4:66724592-66724614 CCAAAAGGTTATTCCTTTCCACT No data
Right 974793947 4:66724615-66724637 TATCCACGGCTGCTAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974793947 Original CRISPR TATCCACGGCTGCTAAAAAG TGG Intergenic
No off target data available for this crispr