ID: 974795219

View in Genome Browser
Species Human (GRCh38)
Location 4:66740355-66740377
Sequence TTTATCAGAGGACCACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974795219_974795221 17 Left 974795219 4:66740355-66740377 CCAGATTGTGGTCCTCTGATAAA No data
Right 974795221 4:66740395-66740417 ATAGACAACAATAAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974795219 Original CRISPR TTTATCAGAGGACCACAATC TGG (reversed) Intergenic
No off target data available for this crispr