ID: 974800061

View in Genome Browser
Species Human (GRCh38)
Location 4:66805401-66805423
Sequence TGGCAGGCCTATAATTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974800057_974800061 6 Left 974800057 4:66805372-66805394 CCCAAACAACTCTAAATTAACAT No data
Right 974800061 4:66805401-66805423 TGGCAGGCCTATAATTACAGAGG No data
974800056_974800061 7 Left 974800056 4:66805371-66805393 CCCCAAACAACTCTAAATTAACA No data
Right 974800061 4:66805401-66805423 TGGCAGGCCTATAATTACAGAGG No data
974800058_974800061 5 Left 974800058 4:66805373-66805395 CCAAACAACTCTAAATTAACATC No data
Right 974800061 4:66805401-66805423 TGGCAGGCCTATAATTACAGAGG No data
974800054_974800061 21 Left 974800054 4:66805357-66805379 CCTGCCTTTTGAAACCCCAAACA No data
Right 974800061 4:66805401-66805423 TGGCAGGCCTATAATTACAGAGG No data
974800055_974800061 17 Left 974800055 4:66805361-66805383 CCTTTTGAAACCCCAAACAACTC No data
Right 974800061 4:66805401-66805423 TGGCAGGCCTATAATTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974800061 Original CRISPR TGGCAGGCCTATAATTACAG AGG Intergenic
No off target data available for this crispr