ID: 974800334

View in Genome Browser
Species Human (GRCh38)
Location 4:66809340-66809362
Sequence TGTGGTCTAGGGATCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974800334_974800341 14 Left 974800334 4:66809340-66809362 CCCCCAGAGATCCCTAGACCACA No data
Right 974800341 4:66809377-66809399 GATACAATTCATCCTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974800334 Original CRISPR TGTGGTCTAGGGATCTCTGG GGG (reversed) Intergenic
No off target data available for this crispr