ID: 974802799

View in Genome Browser
Species Human (GRCh38)
Location 4:66840448-66840470
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974802793_974802799 29 Left 974802793 4:66840396-66840418 CCTTAACATATTCAAGAGTATGA No data
Right 974802799 4:66840448-66840470 TAGGGAAGTAAATCTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr