ID: 974806769

View in Genome Browser
Species Human (GRCh38)
Location 4:66890756-66890778
Sequence TGATGGGTATACCTTTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974806769_974806778 22 Left 974806769 4:66890756-66890778 CCAGTCAAAAGGTATACCCATCA No data
Right 974806778 4:66890801-66890823 GATGCCTCCTCTGATTTAGAGGG No data
974806769_974806777 21 Left 974806769 4:66890756-66890778 CCAGTCAAAAGGTATACCCATCA No data
Right 974806777 4:66890800-66890822 AGATGCCTCCTCTGATTTAGAGG No data
974806769_974806781 29 Left 974806769 4:66890756-66890778 CCAGTCAAAAGGTATACCCATCA No data
Right 974806781 4:66890808-66890830 CCTCTGATTTAGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974806769 Original CRISPR TGATGGGTATACCTTTTGAC TGG (reversed) Intergenic
No off target data available for this crispr