ID: 974807091

View in Genome Browser
Species Human (GRCh38)
Location 4:66894583-66894605
Sequence CCTCTTTGGGAGGGGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974807091_974807102 8 Left 974807091 4:66894583-66894605 CCAGGCCTCCCCTCCCAAAGAGG No data
Right 974807102 4:66894614-66894636 TTAAAGAAAAATAGCTGGGAGGG No data
974807091_974807101 7 Left 974807091 4:66894583-66894605 CCAGGCCTCCCCTCCCAAAGAGG No data
Right 974807101 4:66894613-66894635 ATTAAAGAAAAATAGCTGGGAGG No data
974807091_974807100 4 Left 974807091 4:66894583-66894605 CCAGGCCTCCCCTCCCAAAGAGG No data
Right 974807100 4:66894610-66894632 CACATTAAAGAAAAATAGCTGGG No data
974807091_974807099 3 Left 974807091 4:66894583-66894605 CCAGGCCTCCCCTCCCAAAGAGG No data
Right 974807099 4:66894609-66894631 GCACATTAAAGAAAAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974807091 Original CRISPR CCTCTTTGGGAGGGGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr