ID: 974810043

View in Genome Browser
Species Human (GRCh38)
Location 4:66934311-66934333
Sequence CAGGATATTCAAGCAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974810040_974810043 13 Left 974810040 4:66934275-66934297 CCACTGAGTTGGATCGGTGGGGA No data
Right 974810043 4:66934311-66934333 CAGGATATTCAAGCAGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974810043 Original CRISPR CAGGATATTCAAGCAGTTCA TGG Intergenic
No off target data available for this crispr