ID: 974816201

View in Genome Browser
Species Human (GRCh38)
Location 4:67006975-67006997
Sequence GTATTCTGAAGAATGACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974816199_974816201 26 Left 974816199 4:67006926-67006948 CCAAACTAGTTTAGATGTAGAGG No data
Right 974816201 4:67006975-67006997 GTATTCTGAAGAATGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974816201 Original CRISPR GTATTCTGAAGAATGACCTC TGG Intergenic
No off target data available for this crispr