ID: 974816970

View in Genome Browser
Species Human (GRCh38)
Location 4:67017677-67017699
Sequence TTGAATAATGATGATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974816970_974816971 -9 Left 974816970 4:67017677-67017699 CCATCATCATCATCATTATTCAA No data
Right 974816971 4:67017691-67017713 ATTATTCAACAACAAATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974816970 Original CRISPR TTGAATAATGATGATGATGA TGG (reversed) Intergenic
No off target data available for this crispr