ID: 974819476

View in Genome Browser
Species Human (GRCh38)
Location 4:67047245-67047267
Sequence TCTTGACACAAATGCTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974819474_974819476 -3 Left 974819474 4:67047225-67047247 CCACACTGAGAAGAACATGATCT No data
Right 974819476 4:67047245-67047267 TCTTGACACAAATGCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974819476 Original CRISPR TCTTGACACAAATGCTGAGG TGG Intergenic
No off target data available for this crispr