ID: 974822057

View in Genome Browser
Species Human (GRCh38)
Location 4:67079834-67079856
Sequence CTGTCACCACAGATGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974822052_974822057 2 Left 974822052 4:67079809-67079831 CCCATTATTTCTCCTGTTTAATT No data
Right 974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG No data
974822051_974822057 3 Left 974822051 4:67079808-67079830 CCCCATTATTTCTCCTGTTTAAT No data
Right 974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG No data
974822049_974822057 28 Left 974822049 4:67079783-67079805 CCTTAAGAACTATAAAATTTCCT No data
Right 974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG No data
974822054_974822057 -10 Left 974822054 4:67079821-67079843 CCTGTTTAATTTCCTGTCACCAC No data
Right 974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG No data
974822050_974822057 8 Left 974822050 4:67079803-67079825 CCTATCCCCATTATTTCTCCTGT No data
Right 974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG No data
974822053_974822057 1 Left 974822053 4:67079810-67079832 CCATTATTTCTCCTGTTTAATTT No data
Right 974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974822057 Original CRISPR CTGTCACCACAGATGAGTCT GGG Intergenic
No off target data available for this crispr