ID: 974827310

View in Genome Browser
Species Human (GRCh38)
Location 4:67147994-67148016
Sequence ACAGCAGCTGTCCCCAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974827310_974827312 -6 Left 974827310 4:67147994-67148016 CCTTGCCTGGGGACAGCTGCTGT No data
Right 974827312 4:67148011-67148033 TGCTGTTTCCTCATGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974827310 Original CRISPR ACAGCAGCTGTCCCCAGGCA AGG (reversed) Intergenic
No off target data available for this crispr