ID: 974833582

View in Genome Browser
Species Human (GRCh38)
Location 4:67219034-67219056
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974833582_974833585 26 Left 974833582 4:67219034-67219056 CCCCTTTCTGTAGATTATCTTTT No data
Right 974833585 4:67219083-67219105 CACAAAAGAGTTCAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974833582 Original CRISPR AAAAGATAATCTACAGAAAG GGG (reversed) Intergenic