ID: 974833583 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:67219035-67219057 |
Sequence | GAAAAGATAATCTACAGAAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
974833583_974833585 | 25 | Left | 974833583 | 4:67219035-67219057 | CCCTTTCTGTAGATTATCTTTTC | No data | ||
Right | 974833585 | 4:67219083-67219105 | CACAAAAGAGTTCAACTCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
974833583 | Original CRISPR | GAAAAGATAATCTACAGAAA GGG (reversed) | Intergenic | ||