ID: 974833584

View in Genome Browser
Species Human (GRCh38)
Location 4:67219036-67219058
Sequence TGAAAAGATAATCTACAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974833584_974833585 24 Left 974833584 4:67219036-67219058 CCTTTCTGTAGATTATCTTTTCA No data
Right 974833585 4:67219083-67219105 CACAAAAGAGTTCAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974833584 Original CRISPR TGAAAAGATAATCTACAGAA AGG (reversed) Intergenic