ID: 974833585

View in Genome Browser
Species Human (GRCh38)
Location 4:67219083-67219105
Sequence CACAAAAGAGTTCAACTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974833583_974833585 25 Left 974833583 4:67219035-67219057 CCCTTTCTGTAGATTATCTTTTC No data
Right 974833585 4:67219083-67219105 CACAAAAGAGTTCAACTCTGAGG No data
974833582_974833585 26 Left 974833582 4:67219034-67219056 CCCCTTTCTGTAGATTATCTTTT No data
Right 974833585 4:67219083-67219105 CACAAAAGAGTTCAACTCTGAGG No data
974833584_974833585 24 Left 974833584 4:67219036-67219058 CCTTTCTGTAGATTATCTTTTCA No data
Right 974833585 4:67219083-67219105 CACAAAAGAGTTCAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974833585 Original CRISPR CACAAAAGAGTTCAACTCTG AGG Intergenic