ID: 974836417

View in Genome Browser
Species Human (GRCh38)
Location 4:67256632-67256654
Sequence AATTTACAGTAATTAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974836417_974836422 3 Left 974836417 4:67256632-67256654 CCTACTTTTAATTACTGTAAATT No data
Right 974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG No data
974836417_974836424 26 Left 974836417 4:67256632-67256654 CCTACTTTTAATTACTGTAAATT No data
Right 974836424 4:67256681-67256703 AGTAGTTCAATGCAAATTTAGGG No data
974836417_974836423 25 Left 974836417 4:67256632-67256654 CCTACTTTTAATTACTGTAAATT No data
Right 974836423 4:67256680-67256702 GAGTAGTTCAATGCAAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974836417 Original CRISPR AATTTACAGTAATTAAAAGT AGG (reversed) Intergenic
No off target data available for this crispr