ID: 974836422

View in Genome Browser
Species Human (GRCh38)
Location 4:67256658-67256680
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974836417_974836422 3 Left 974836417 4:67256632-67256654 CCTACTTTTAATTACTGTAAATT No data
Right 974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type