ID: 974837048

View in Genome Browser
Species Human (GRCh38)
Location 4:67263812-67263834
Sequence CTAGAATTTCTTCCTCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974837048_974837051 9 Left 974837048 4:67263812-67263834 CCACCTAGAGGAAGAAATTCTAG No data
Right 974837051 4:67263844-67263866 GTAAAGAGTATAAAAGAGTCAGG No data
974837048_974837052 14 Left 974837048 4:67263812-67263834 CCACCTAGAGGAAGAAATTCTAG No data
Right 974837052 4:67263849-67263871 GAGTATAAAAGAGTCAGGAAAGG No data
974837048_974837053 23 Left 974837048 4:67263812-67263834 CCACCTAGAGGAAGAAATTCTAG No data
Right 974837053 4:67263858-67263880 AGAGTCAGGAAAGGTGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974837048 Original CRISPR CTAGAATTTCTTCCTCTAGG TGG (reversed) Intergenic
No off target data available for this crispr