ID: 974837049

View in Genome Browser
Species Human (GRCh38)
Location 4:67263815-67263837
Sequence GTTCTAGAATTTCTTCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974837049_974837053 20 Left 974837049 4:67263815-67263837 CCTAGAGGAAGAAATTCTAGAAC No data
Right 974837053 4:67263858-67263880 AGAGTCAGGAAAGGTGTTTTAGG No data
974837049_974837051 6 Left 974837049 4:67263815-67263837 CCTAGAGGAAGAAATTCTAGAAC No data
Right 974837051 4:67263844-67263866 GTAAAGAGTATAAAAGAGTCAGG No data
974837049_974837052 11 Left 974837049 4:67263815-67263837 CCTAGAGGAAGAAATTCTAGAAC No data
Right 974837052 4:67263849-67263871 GAGTATAAAAGAGTCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974837049 Original CRISPR GTTCTAGAATTTCTTCCTCT AGG (reversed) Intergenic
No off target data available for this crispr