ID: 974837052

View in Genome Browser
Species Human (GRCh38)
Location 4:67263849-67263871
Sequence GAGTATAAAAGAGTCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974837048_974837052 14 Left 974837048 4:67263812-67263834 CCACCTAGAGGAAGAAATTCTAG No data
Right 974837052 4:67263849-67263871 GAGTATAAAAGAGTCAGGAAAGG No data
974837049_974837052 11 Left 974837049 4:67263815-67263837 CCTAGAGGAAGAAATTCTAGAAC No data
Right 974837052 4:67263849-67263871 GAGTATAAAAGAGTCAGGAAAGG No data
974837047_974837052 15 Left 974837047 4:67263811-67263833 CCCACCTAGAGGAAGAAATTCTA No data
Right 974837052 4:67263849-67263871 GAGTATAAAAGAGTCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974837052 Original CRISPR GAGTATAAAAGAGTCAGGAA AGG Intergenic
No off target data available for this crispr