ID: 974838458

View in Genome Browser
Species Human (GRCh38)
Location 4:67277024-67277046
Sequence TGGGGTTTCCCCCAGAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974838456_974838458 -8 Left 974838456 4:67277009-67277031 CCTTGTGGTATTTAATGGGGTTT No data
Right 974838458 4:67277024-67277046 TGGGGTTTCCCCCAGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974838458 Original CRISPR TGGGGTTTCCCCCAGAGGTT AGG Intergenic
No off target data available for this crispr