ID: 974841794

View in Genome Browser
Species Human (GRCh38)
Location 4:67307594-67307616
Sequence CAGAGAACAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974841794_974841800 19 Left 974841794 4:67307594-67307616 CCATCCACCACTGCTGTTCTCTG No data
Right 974841800 4:67307636-67307658 GACTTCCACCTCTCCAGATCCGG No data
974841794_974841803 24 Left 974841794 4:67307594-67307616 CCATCCACCACTGCTGTTCTCTG No data
Right 974841803 4:67307641-67307663 CCACCTCTCCAGATCCGGCAGGG No data
974841794_974841801 23 Left 974841794 4:67307594-67307616 CCATCCACCACTGCTGTTCTCTG No data
Right 974841801 4:67307640-67307662 TCCACCTCTCCAGATCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974841794 Original CRISPR CAGAGAACAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr