ID: 974844857

View in Genome Browser
Species Human (GRCh38)
Location 4:67340030-67340052
Sequence TTTGGACTTTTGTCTATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974844857_974844862 7 Left 974844857 4:67340030-67340052 CCATCTATAGACAAAAGTCCAAA No data
Right 974844862 4:67340060-67340082 ATGTCCCCACAGATGGAAGAAGG No data
974844857_974844859 0 Left 974844857 4:67340030-67340052 CCATCTATAGACAAAAGTCCAAA No data
Right 974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974844857 Original CRISPR TTTGGACTTTTGTCTATAGA TGG (reversed) Intergenic
No off target data available for this crispr