ID: 974844862

View in Genome Browser
Species Human (GRCh38)
Location 4:67340060-67340082
Sequence ATGTCCCCACAGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974844857_974844862 7 Left 974844857 4:67340030-67340052 CCATCTATAGACAAAAGTCCAAA No data
Right 974844862 4:67340060-67340082 ATGTCCCCACAGATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974844862 Original CRISPR ATGTCCCCACAGATGGAAGA AGG Intergenic
No off target data available for this crispr