ID: 974849472

View in Genome Browser
Species Human (GRCh38)
Location 4:67387444-67387466
Sequence TTTTCTCCCAACAAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974849470_974849472 5 Left 974849470 4:67387416-67387438 CCTTGTCAGCAAAGGACACTGTG No data
Right 974849472 4:67387444-67387466 TTTTCTCCCAACAAGTAGGCAGG No data
974849468_974849472 25 Left 974849468 4:67387396-67387418 CCTTTTTAAAATGCGTTTATCCT No data
Right 974849472 4:67387444-67387466 TTTTCTCCCAACAAGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974849472 Original CRISPR TTTTCTCCCAACAAGTAGGC AGG Intergenic
No off target data available for this crispr