ID: 974850797

View in Genome Browser
Species Human (GRCh38)
Location 4:67403223-67403245
Sequence CTCAGGAAAGCTGCTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974850789_974850797 1 Left 974850789 4:67403199-67403221 CCATGGCGAGCCAACCTCCCAAG No data
Right 974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG No data
974850788_974850797 9 Left 974850788 4:67403191-67403213 CCTAAGATCCATGGCGAGCCAAC No data
Right 974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG No data
974850792_974850797 -9 Left 974850792 4:67403209-67403231 CCAACCTCCCAAGGCTCAGGAAA No data
Right 974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974850797 Original CRISPR CTCAGGAAAGCTGCTCATGG TGG Intergenic
No off target data available for this crispr