ID: 974850814

View in Genome Browser
Species Human (GRCh38)
Location 4:67403327-67403349
Sequence AGTGGTCCAAGTAGCGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974850814_974850818 13 Left 974850814 4:67403327-67403349 CCCTGGACGCTACTTGGACCACT No data
Right 974850818 4:67403363-67403385 GTAAGACATTCTGTTCTAGGAGG No data
974850814_974850817 10 Left 974850814 4:67403327-67403349 CCCTGGACGCTACTTGGACCACT No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850814_974850819 20 Left 974850814 4:67403327-67403349 CCCTGGACGCTACTTGGACCACT No data
Right 974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974850814 Original CRISPR AGTGGTCCAAGTAGCGTCCA GGG (reversed) Intergenic
No off target data available for this crispr