ID: 974850815

View in Genome Browser
Species Human (GRCh38)
Location 4:67403328-67403350
Sequence CAGTGGTCCAAGTAGCGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974850815_974850820 30 Left 974850815 4:67403328-67403350 CCTGGACGCTACTTGGACCACTG No data
Right 974850820 4:67403381-67403403 GGAGGAACAAGGATATATTCTGG No data
974850815_974850819 19 Left 974850815 4:67403328-67403350 CCTGGACGCTACTTGGACCACTG No data
Right 974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG No data
974850815_974850817 9 Left 974850815 4:67403328-67403350 CCTGGACGCTACTTGGACCACTG No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850815_974850818 12 Left 974850815 4:67403328-67403350 CCTGGACGCTACTTGGACCACTG No data
Right 974850818 4:67403363-67403385 GTAAGACATTCTGTTCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974850815 Original CRISPR CAGTGGTCCAAGTAGCGTCC AGG (reversed) Intergenic
No off target data available for this crispr