ID: 974850816

View in Genome Browser
Species Human (GRCh38)
Location 4:67403345-67403367
Sequence CTTACAATGCTTGAACTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974850816_974850817 -8 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850816_974850820 13 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850820 4:67403381-67403403 GGAGGAACAAGGATATATTCTGG No data
974850816_974850818 -5 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850818 4:67403363-67403385 GTAAGACATTCTGTTCTAGGAGG No data
974850816_974850819 2 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG No data
974850816_974850821 14 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850821 4:67403382-67403404 GAGGAACAAGGATATATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974850816 Original CRISPR CTTACAATGCTTGAACTCAG TGG (reversed) Intergenic
No off target data available for this crispr