ID: 974850817

View in Genome Browser
Species Human (GRCh38)
Location 4:67403360-67403382
Sequence ATTGTAAGACATTCTGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974850812_974850817 23 Left 974850812 4:67403314-67403336 CCTGGGTTTTATACCCTGGACGC No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850809_974850817 29 Left 974850809 4:67403308-67403330 CCATGCCCTGGGTTTTATACCCT No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850815_974850817 9 Left 974850815 4:67403328-67403350 CCTGGACGCTACTTGGACCACTG No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850816_974850817 -8 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850814_974850817 10 Left 974850814 4:67403327-67403349 CCCTGGACGCTACTTGGACCACT No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data
974850811_974850817 24 Left 974850811 4:67403313-67403335 CCCTGGGTTTTATACCCTGGACG No data
Right 974850817 4:67403360-67403382 ATTGTAAGACATTCTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974850817 Original CRISPR ATTGTAAGACATTCTGTTCT AGG Intergenic
No off target data available for this crispr