ID: 974850819

View in Genome Browser
Species Human (GRCh38)
Location 4:67403370-67403392
Sequence ATTCTGTTCTAGGAGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974850815_974850819 19 Left 974850815 4:67403328-67403350 CCTGGACGCTACTTGGACCACTG No data
Right 974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG No data
974850816_974850819 2 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG No data
974850814_974850819 20 Left 974850814 4:67403327-67403349 CCCTGGACGCTACTTGGACCACT No data
Right 974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974850819 Original CRISPR ATTCTGTTCTAGGAGGAACA AGG Intergenic
No off target data available for this crispr