ID: 974850820

View in Genome Browser
Species Human (GRCh38)
Location 4:67403381-67403403
Sequence GGAGGAACAAGGATATATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974850816_974850820 13 Left 974850816 4:67403345-67403367 CCACTGAGTTCAAGCATTGTAAG No data
Right 974850820 4:67403381-67403403 GGAGGAACAAGGATATATTCTGG No data
974850815_974850820 30 Left 974850815 4:67403328-67403350 CCTGGACGCTACTTGGACCACTG No data
Right 974850820 4:67403381-67403403 GGAGGAACAAGGATATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974850820 Original CRISPR GGAGGAACAAGGATATATTC TGG Intergenic
No off target data available for this crispr