ID: 974860684

View in Genome Browser
Species Human (GRCh38)
Location 4:67517545-67517567
Sequence ACTGCATTGTCGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974860680_974860684 -1 Left 974860680 4:67517523-67517545 CCTAACATAACGATTTCTAAATA 0: 1
1: 0
2: 2
3: 18
4: 272
Right 974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG 0: 1
1: 0
2: 4
3: 59
4: 419
974860679_974860684 23 Left 974860679 4:67517499-67517521 CCTATGATAGTGACATAAGGGCA 0: 1
1: 0
2: 0
3: 1
4: 82
Right 974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG 0: 1
1: 0
2: 4
3: 59
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974860684 Original CRISPR ACTGCATTGTCGGCCGGGTG CGG Intronic
900211332 1:1457302-1457324 ACAGCATTTTTGGCCAGGTGTGG + Intronic
900217686 1:1490437-1490459 CCTGGATTGGGGGCCGGGTGAGG - Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
901210602 1:7523586-7523608 ATTTCATTTTTGGCCGGGTGCGG + Intronic
901487089 1:9571565-9571587 AGAGCCTTCTCGGCCGGGTGGGG - Intronic
901793439 1:11666670-11666692 AATGCTTTGCAGGCCGGGTGCGG - Intronic
902054492 1:13588953-13588975 AATGAATTGTTGGCCGGGTATGG - Intronic
903984697 1:27218124-27218146 AATGCAATGTAGGTCGGGTGTGG + Intergenic
904171762 1:28596329-28596351 ACTGCATTTTTGGCTGGATGTGG + Intronic
904704818 1:32381934-32381956 AGTTCAATGTGGGCCGGGTGCGG + Intronic
904800289 1:33087724-33087746 AATGCATTGCCAGTCGGGTGTGG - Intronic
905438053 1:37972888-37972910 ACTTAAATGTGGGCCGGGTGCGG + Intronic
905586186 1:39120650-39120672 TTTGCATTGTTGGCCGGGTGTGG - Intronic
905697670 1:39987320-39987342 ACTGCTCTGTCGGCTGGGTGTGG + Intergenic
906214361 1:44030452-44030474 TCTGCAGTGGCTGCCGGGTGCGG + Intronic
907166769 1:52419063-52419085 AATGCATTTTTGGCCAGGTGCGG + Exonic
907688804 1:56642139-56642161 ACTGCAATTTAGGCCTGGTGCGG + Intronic
907880706 1:58546805-58546827 GCTGTATTGACTGCCGGGTGTGG - Intergenic
908317513 1:62947838-62947860 ACTACATTTTTGGCCGGGTGTGG + Intergenic
909143547 1:71898323-71898345 ACTGCTTTGCTGGCCGGGCGCGG + Intronic
910759277 1:90718799-90718821 ACTGCGGTGTCGGGCGGGCGCGG + Intergenic
911206851 1:95100282-95100304 CCTGCATTGCTGGCTGGGTGCGG + Intergenic
912694728 1:111832686-111832708 ACTGCATTCTGGGCGGGGTGGGG - Intronic
912918704 1:113843938-113843960 AATCCATTCTGGGCCGGGTGTGG + Intronic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
915378926 1:155423288-155423310 ACTGCATTTTCGGCCAGGCATGG + Intronic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
916752258 1:167733964-167733986 AATGCACTGTAGGCCGGGTGCGG + Intronic
920091930 1:203460564-203460586 TATGAATTGTCGGCCGGGCGCGG + Intergenic
920402564 1:205685572-205685594 ACTGCAAAATTGGCCGGGTGTGG - Intergenic
921306632 1:213803535-213803557 ACTACATTGTTGGCTGGGTGTGG - Intergenic
922176395 1:223201193-223201215 ACTGCACTTTCGGCCGGGTGCGG + Intergenic
922512775 1:226183470-226183492 ATTACATTTTCGGCCGGGTGTGG - Intronic
922625465 1:227036718-227036740 ACTGAATTGAAGGCCGGGCGCGG - Intronic
922922560 1:229318848-229318870 AGTGCAGTGCTGGCCGGGTGTGG - Intergenic
922947784 1:229531495-229531517 GCTGCATGGCGGGCCGGGTGAGG - Intronic
923085184 1:230697905-230697927 AATGTATTATTGGCCGGGTGCGG + Intergenic
923229672 1:231973334-231973356 AAGACATTGGCGGCCGGGTGCGG - Intronic
923642792 1:235782461-235782483 TCCCCATTGTAGGCCGGGTGTGG - Intronic
924558320 1:245136142-245136164 ACTGCAATGAGGGCCGGGCGTGG - Intergenic
1062867399 10:867568-867590 ACTCCAGCGTCGGCCGGGTGTGG + Intronic
1063626524 10:7695448-7695470 ACTAGGTTGTTGGCCGGGTGCGG - Intergenic
1064036760 10:11919906-11919928 AATACATTCTCGGCCGGGTGCGG - Intergenic
1064259265 10:13771787-13771809 AGTGCATTGCCAGCTGGGTGCGG + Intronic
1065048108 10:21762225-21762247 ATTGCATTTTCGGCTGGGCGTGG - Intronic
1065883184 10:30054957-30054979 GATGCATTTTCGGCCGGGCGCGG - Intronic
1066461607 10:35617239-35617261 AATGCATTCTGGGCTGGGTGTGG - Intergenic
1067345070 10:45431860-45431882 ACTTTATAGTTGGCCGGGTGCGG - Intronic
1069682325 10:70294095-70294117 ACTGTAGTGTCAGCCGGGCGCGG - Intergenic
1070112470 10:73498562-73498584 ACTGTACTGTGGGCCGGGCGCGG - Exonic
1070305704 10:75238004-75238026 AATGGATTCTTGGCCGGGTGCGG - Intergenic
1071034129 10:81222900-81222922 ATAGCATTGCCGGCCGGGCGTGG + Intergenic
1071297944 10:84236004-84236026 AACGTATTGCCGGCCGGGTGCGG + Intronic
1071501571 10:86207918-86207940 ACTGCATCTGCGGCCGGGCGCGG - Intronic
1074098585 10:110335056-110335078 ACTGCATAGGGGGCCGGGCGTGG + Intergenic
1075246016 10:120822706-120822728 ATGGCAGAGTCGGCCGGGTGCGG - Intergenic
1076368264 10:129935979-129936001 GCTGCATTGTTGGGCGGGGGGGG - Intronic
1077062282 11:623016-623038 ACTGGATTGTCAGCCGGGCACGG + Intronic
1077929037 11:6711255-6711277 AATGCATGTTTGGCCGGGTGTGG - Intergenic
1079235774 11:18688769-18688791 AATGCCTTTTAGGCCGGGTGTGG - Intergenic
1081133542 11:39409614-39409636 ACTGCAGTGGAGGCTGGGTGCGG + Intergenic
1081900377 11:46622405-46622427 AATGCATTCTTGGCCAGGTGCGG - Intronic
1081923283 11:46799706-46799728 AATGAATTTTAGGCCGGGTGTGG + Intronic
1081965385 11:47166150-47166172 AGAGCATTTTCGGCCGGGTGTGG - Intronic
1084037669 11:66522634-66522656 AATGCATGTTAGGCCGGGTGTGG - Intronic
1084069343 11:66724128-66724150 ACTGATTTTTTGGCCGGGTGCGG + Intronic
1084081752 11:66831703-66831725 TGTACATTTTCGGCCGGGTGCGG + Intronic
1084135723 11:67179568-67179590 ACAGCATTCCAGGCCGGGTGCGG - Intronic
1084761777 11:71277606-71277628 AATTCATTGTTGGCCGGGTGTGG + Intergenic
1086090564 11:83000761-83000783 AAGGCTTTGTCGGCCGGGCGCGG + Intronic
1086102175 11:83112492-83112514 ACAGCATTGGTGGCCAGGTGTGG + Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1089531053 11:119129752-119129774 ACCACATTTTGGGCCGGGTGCGG - Intronic
1090773598 11:129944302-129944324 ATTGCAATCTCGGCCGGGCGCGG + Intronic
1090930073 11:131289651-131289673 ACTGCAAGGTGGGCCGGGCGCGG - Intergenic
1090998981 11:131892589-131892611 ACTGCATTGTCGGCATGGTGCGG + Intronic
1091428072 12:408913-408935 ACTACATTTTAGGCCGGGCGTGG + Intronic
1092133637 12:6130561-6130583 ACATGCTTGTCGGCCGGGTGCGG - Intergenic
1092273298 12:7040036-7040058 ACTGCAGCCTGGGCCGGGTGTGG - Intronic
1092880897 12:12887137-12887159 AATGCATTGTGGGCCAGGCGCGG - Intergenic
1093166865 12:15814199-15814221 ATTGCATTGTTAGCCAGGTGTGG - Intronic
1093519618 12:20033130-20033152 AAAGCATAGACGGCCGGGTGTGG + Intergenic
1095460016 12:42433610-42433632 AATACAGTGTGGGCCGGGTGCGG - Intronic
1095774620 12:45998922-45998944 AGTTCATTGTAGGCCGGGTGTGG - Intergenic
1096195731 12:49647788-49647810 ACTGCATTGTAGGCCTCCTGGGG + Exonic
1096356261 12:50943418-50943440 TCTGCAGTTTAGGCCGGGTGTGG + Intergenic
1096388749 12:51213225-51213247 ACTGCATTAGAGGCCGGGCGCGG - Intronic
1099343831 12:81473115-81473137 ACTGCATGTAGGGCCGGGTGCGG + Intronic
1099832034 12:87856433-87856455 ATATCATTGTCGGCCGGGCGCGG - Intergenic
1101356756 12:103986209-103986231 AATGCACTGTAGGCCGGGTGCGG - Intronic
1101661576 12:106770514-106770536 AATGCAGTCTCAGCCGGGTGCGG - Intronic
1101793652 12:107953320-107953342 AGACCATTGTCGGCCGGGTGTGG - Intergenic
1101908833 12:108847851-108847873 CCTGCATTGTAAGGCGGGTGTGG + Intronic
1102125068 12:110473500-110473522 ACTCTATTGTGGGCTGGGTGTGG - Intronic
1102343221 12:112140128-112140150 ACTGAATTGGAGGCCGGGCGTGG + Intronic
1103388234 12:120550884-120550906 GCCGCATTCTGGGCCGGGTGTGG - Intronic
1103638694 12:122330889-122330911 ACTACATTGTAGGCCGGGCGTGG - Intronic
1103828212 12:123757148-123757170 ATTGTATTTTGGGCCGGGTGCGG + Intronic
1104118888 12:125778877-125778899 ATTGTGTTCTCGGCCGGGTGCGG + Intergenic
1105324945 13:19362146-19362168 AATGCATTTTGGGCTGGGTGCGG - Intergenic
1105599181 13:21870601-21870623 AATGCATTCTTGGCCAGGTGCGG + Intergenic
1106417093 13:29555066-29555088 ATTACATTGTGGGCCGGGCGCGG + Intronic
1106579512 13:31005256-31005278 TGTGCATTCTCCGCCGGGTGAGG - Intergenic
1107682220 13:42864114-42864136 ACTGCAGTATCAGCCGGGCGCGG + Intergenic
1111724374 13:91986353-91986375 AATGTATTGGCGGCCGGGCGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114042934 14:18695462-18695484 AATGCAAGGTTGGCCGGGTGCGG - Intergenic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1115556683 14:34549810-34549832 ACGGAACTGTCGGCCGGGCGCGG + Intergenic
1116817231 14:49595720-49595742 AATCCATTGTCGGCAGGGCGCGG + Intronic
1119524190 14:75309257-75309279 ACTGCATCATAGGCCGGGTGCGG - Intergenic
1119656735 14:76422499-76422521 AAGGAAATGTCGGCCGGGTGTGG - Intronic
1120114067 14:80593254-80593276 ACCCTGTTGTCGGCCGGGTGAGG + Intronic
1120304150 14:82746678-82746700 CCTGCATTATCGGGCGGGTGCGG + Intergenic
1120986769 14:90341986-90342008 ACTGCATTGCCGGCCGGGCTCGG + Intergenic
1121634412 14:95443951-95443973 AGTGCATTTTAGGCCGGGAGCGG - Intronic
1122655222 14:103254263-103254285 AGTGCACTCCCGGCCGGGTGCGG + Intergenic
1122725732 14:103750538-103750560 ACTGGATTGCAGGCCGGGTGCGG + Intronic
1123438716 15:20274298-20274320 ACTGCACAGTAGGCCAGGTGTGG + Intergenic
1123700395 15:22910448-22910470 ACTGGGTTTTCGGCTGGGTGCGG - Intronic
1124596277 15:31093890-31093912 ATTGCTTTGTCGGCCATGTGCGG - Intronic
1125996102 15:44162575-44162597 ACTCCCATGTCGGCCGGGCGCGG + Intronic
1126006758 15:44265236-44265258 ACTTCACTCTTGGCCGGGTGTGG - Intergenic
1127113620 15:55701244-55701266 TCTGCATTCTTGGCCGGGCGCGG + Intronic
1127590664 15:60419136-60419158 ACAGCACTGGAGGCCGGGTGCGG - Intergenic
1127622008 15:60743303-60743325 AATGCATTTACAGCCGGGTGCGG - Intronic
1127721878 15:61709965-61709987 AATTCATTGGCGGCCGGGTGTGG - Intergenic
1127813138 15:62581751-62581773 AGTGAATAGTGGGCCGGGTGCGG + Intronic
1128199842 15:65795099-65795121 ACTGCTTTATGGGCCGGGTGTGG - Intronic
1128232060 15:66042398-66042420 TGTGCATTCTTGGCCGGGTGTGG - Intronic
1128803114 15:70509741-70509763 CCTGGCTTGTCTGCCGGGTGGGG - Intergenic
1128987704 15:72233159-72233181 GGTGCATAGTAGGCCGGGTGCGG + Intergenic
1129369759 15:75083770-75083792 ACCCCATCGTTGGCCGGGTGCGG - Intronic
1129477233 15:75793883-75793905 ACTGCATGCAAGGCCGGGTGTGG - Intergenic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1131624328 15:94101601-94101623 ACTTACTTGTCGGCCGGGCGCGG + Intergenic
1132475294 16:132957-132979 AGTGCAAGGTGGGCCGGGTGCGG - Intronic
1132560083 16:589629-589651 ACGGCGTTGTGGGCCGGGGGCGG + Intronic
1133261675 16:4554917-4554939 AGGGCATTGTCGGCTGGGCGCGG - Intergenic
1133858762 16:9574460-9574482 ACGGCATTGCTGGCCGGGCGCGG - Intergenic
1136218428 16:28811429-28811451 ACAGCAGTGTTGGCCGGGCGAGG - Intergenic
1139771194 16:69278744-69278766 ACTGCAATATTGGCTGGGTGTGG - Intronic
1139783040 16:69367541-69367563 AGTGTGTTGTAGGCCGGGTGTGG - Intronic
1140090776 16:71836865-71836887 TCTACTTTGTAGGCCGGGTGCGG + Intergenic
1140435148 16:74940992-74941014 ACAGCATTTTCGGCTGGGCGCGG - Intronic
1141504990 16:84471027-84471049 AAAGCACTGTTGGCCGGGTGTGG + Intergenic
1142902966 17:3025084-3025106 AGTACATTGACGGCCAGGTGCGG + Intronic
1143197872 17:5089946-5089968 AGTGCATTTTTGGCAGGGTGTGG - Intronic
1143456324 17:7070202-7070224 GAGGCATTGTCGGCCGGGCGCGG + Intergenic
1144066625 17:11630142-11630164 ACTGTATTGCAGGCCAGGTGCGG + Intronic
1144185719 17:12793415-12793437 CCTGCATTCTAGGCCGGGCGTGG + Intronic
1144267653 17:13586575-13586597 ACTGGATTTTAGGCCGGGCGCGG + Intronic
1144477448 17:15600757-15600779 AATATATTGTCGGCCGGGCGCGG + Intronic
1144480779 17:15627440-15627462 AGTCCAGTGTCGGCCGGGGGCGG + Intronic
1144507093 17:15841330-15841352 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1144567381 17:16371136-16371158 AATGAATTGTAGGCTGGGTGTGG - Intergenic
1144824934 17:18100483-18100505 ACTGCATTGGCTGGCGGCTGAGG + Intronic
1144920792 17:18762610-18762632 AATATATTGTCGGCCGGGCGTGG - Intronic
1145092738 17:19999353-19999375 ACTGTACTCTGGGCCGGGTGTGG + Intergenic
1145117259 17:20223383-20223405 ATTTCAATCTCGGCCGGGTGCGG + Intronic
1145171219 17:20658927-20658949 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1146064274 17:29622653-29622675 GCTGCGGTGACGGCCGGGTGTGG + Intronic
1146777354 17:35633070-35633092 ACTGCAGAATCGGCCGGGCGCGG + Intronic
1147004875 17:37394584-37394606 AGTGCATTCTCGGCCGGGCGCGG + Intronic
1147919752 17:43908442-43908464 ACTGCATCTTTGGCCGGGCGCGG + Intronic
1149230828 17:54531892-54531914 ACTGCCTTCTTGGCCAGGTGTGG - Intergenic
1149802336 17:59581482-59581504 TATGTATTGTAGGCCGGGTGCGG + Intronic
1149844156 17:59994008-59994030 TATGTATTGTAGGCCGGGTGCGG - Intergenic
1149968611 17:61193465-61193487 ACTGAATTTTTGGCCAGGTGCGG + Intronic
1150042650 17:61880334-61880356 AGTGCAGTGTAGGCCGGGCGTGG - Intronic
1150124238 17:62626577-62626599 ACTGTAATATGGGCCGGGTGCGG - Intergenic
1150908476 17:69363311-69363333 ATTGCAAAGTGGGCCGGGTGTGG - Intergenic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1151523170 17:74645697-74645719 AGTGCAAGGTAGGCCGGGTGCGG + Intergenic
1151632858 17:75322827-75322849 TCGGCATTCTCGGCCGGATGCGG + Intronic
1151827769 17:76532825-76532847 AAGTCATTGTCGGCCGGGCGTGG - Intronic
1151864914 17:76794982-76795004 AGTACATTTTCGGCTGGGTGTGG - Intergenic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1152675382 17:81637506-81637528 ACTGCATTTCAGGCCGGGCGCGG + Intronic
1153034621 18:749201-749223 ACTGCATTTCTGGCCGGGCGCGG + Intronic
1153469503 18:5428043-5428065 AATCCAGTCTCGGCCGGGTGCGG - Intronic
1154005909 18:10526897-10526919 TCAGCATTGTGGGCCGGGCGCGG + Intronic
1154235426 18:12601128-12601150 ACTGCTTTATTGGCTGGGTGCGG + Intronic
1154241242 18:12656187-12656209 ACAGCAATGTCTGCCAGGTGCGG - Intronic
1156330114 18:36113387-36113409 ATTGCACAGTCGGCTGGGTGCGG - Intronic
1157428225 18:47602199-47602221 ACTCCAATGTCGCCCGTGTGTGG - Intergenic
1157904493 18:51557221-51557243 AGTGCATTGTGTGCCAGGTGGGG - Intergenic
1157961023 18:52153422-52153444 CCTTCATTGTAGGCCAGGTGCGG - Intergenic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1159331221 18:66996353-66996375 ACTCCATAGTCAGCTGGGTGTGG + Intergenic
1159526337 18:69595977-69595999 ACTTCATTTTCAACCGGGTGTGG + Intronic
1159695446 18:71551854-71551876 AGCTCAGTGTCGGCCGGGTGCGG - Intergenic
1161731111 19:5961151-5961173 ACTGCAGTGTTGGCCGGGCGCGG + Intronic
1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG + Intergenic
1161892274 19:7049003-7049025 ATGGAATTGTCGGCCGGGTGCGG - Intergenic
1161968906 19:7564898-7564920 AACGTATTGTCGGCTGGGTGAGG - Intergenic
1162532980 19:11246552-11246574 ACTTCAGTGTCGGCGGGGCGCGG - Intronic
1162862029 19:13513366-13513388 TCACCATAGTCGGCCGGGTGCGG + Intronic
1163022697 19:14491817-14491839 AAATCAGTGTCGGCCGGGTGTGG + Intronic
1163729864 19:18942578-18942600 ACTCAAGTGTCGGCCAGGTGTGG - Intergenic
1165034680 19:33024143-33024165 ACTGCACAGGAGGCCGGGTGTGG + Intronic
1165866715 19:38943878-38943900 AATGAATTTTGGGCCGGGTGTGG - Intronic
1166040543 19:40199866-40199888 ACTCCTTTGGAGGCCGGGTGCGG + Intronic
1166404901 19:42513306-42513328 ACTGCACTGCAGGCCGGGCGCGG + Intronic
1166703535 19:44895835-44895857 CTTGCATGGTCGGCCGGGCGCGG - Intronic
1166826410 19:45612352-45612374 ACTGCATATGTGGCCGGGTGCGG - Intronic
1167333506 19:48870695-48870717 CCAGCCTGGTCGGCCGGGTGCGG + Intergenic
1167398159 19:49245308-49245330 ACTGCAATGGGGGCCAGGTGCGG - Intergenic
1168383411 19:55943190-55943212 ACTGTGCTGTCGGCCAGGTGCGG + Intergenic
1168576799 19:57518573-57518595 ACTGCATCTTTGGCTGGGTGTGG - Intergenic
1168702183 19:58447266-58447288 CCTGCATTGTCGGCCAGGCATGG - Intergenic
925591929 2:5518218-5518240 CCTCCATTGTCAGCCGGGCGCGG - Intergenic
925972747 2:9118497-9118519 ACTGCATTACAGGCCGGGCGTGG - Intergenic
926057375 2:9781986-9782008 ACTGAGTTGTTGGCCGGGTGAGG - Intergenic
926570787 2:14527678-14527700 AATGTATTGTGGGCCAGGTGTGG - Intergenic
926687867 2:15711954-15711976 AATGCATGGTTGGCCGGGCGCGG + Intronic
927953539 2:27190977-27190999 ACTACATTTTGGGCCAGGTGTGG - Intergenic
928116158 2:28546438-28546460 ACTGCAGTGTGGGAGGGGTGAGG - Intronic
929156311 2:38791586-38791608 CCTACATTGTCTCCCGGGTGAGG + Intergenic
929159093 2:38813660-38813682 TATACATTTTCGGCCGGGTGCGG - Intronic
929213406 2:39384234-39384256 ACAGCACTGTCGGCCGGGCATGG + Intronic
929303504 2:40333146-40333168 ACTGTCTTTTAGGCCGGGTGCGG + Intronic
929826501 2:45312745-45312767 AGTACATTGTAGGCCAGGTGTGG + Intergenic
930061450 2:47292590-47292612 ATTGCATTGTTGGCTGGGTGTGG - Intergenic
930361357 2:50384214-50384236 AATGCATTCTCAGCCGGGTGCGG + Intronic
931465582 2:62483889-62483911 TCTGTATCGTAGGCCGGGTGTGG - Intergenic
931599418 2:63988988-63989010 AATGCATTCTCGGCCGGGAAGGG + Intronic
933921308 2:87049990-87050012 ACTATATTGCTGGCCGGGTGTGG + Intergenic
935294997 2:101641194-101641216 ACTTTATTGTGGGCCAGGTGTGG + Intergenic
936362804 2:111821640-111821662 ACTATATTGCTGGCCGGGTGTGG + Intronic
937114380 2:119394017-119394039 CCTCCATTGTTGGCTGGGTGCGG - Intergenic
938153760 2:128909988-128910010 ATTGTTTTGTCAGCCGGGTGCGG + Intergenic
940867293 2:158829990-158830012 ATGGCACCGTCGGCCGGGTGTGG - Intronic
942087673 2:172458393-172458415 ACTTCATTCTTGGCCGGGTGCGG - Intronic
942272016 2:174285789-174285811 ATTGGGCTGTCGGCCGGGTGTGG - Intergenic
942285651 2:174413160-174413182 AGAGCACTATCGGCCGGGTGTGG - Intronic
942481612 2:176394239-176394261 AATGGATTGACGGCCGGGCGTGG + Intergenic
943120611 2:183730331-183730353 ACTGCCTTGTAGGCTGGGCGTGG - Intergenic
943712048 2:191107998-191108020 TATCCATTGTTGGCCGGGTGCGG + Intronic
944622520 2:201531247-201531269 ACTGCAGGGTCGGCCAGGCGCGG - Intronic
944878516 2:203987178-203987200 ACTGTATTTTGGGCCGGGCGCGG - Intergenic
945526114 2:210889665-210889687 GATGCATAGTCGGCTGGGTGCGG + Intergenic
946663631 2:222027544-222027566 AAAGCAATGTAGGCCGGGTGTGG + Intergenic
947042548 2:225940218-225940240 ACTGCTTAGTCGGCCGGGCGCGG - Intergenic
947973796 2:234346638-234346660 TCTGCTTTTTCAGCCGGGTGCGG + Intergenic
948339415 2:237237572-237237594 ACTGCAGTGTGGGCCGGGCATGG + Intergenic
948462161 2:238135002-238135024 AATTCAATGTCGGCCGGGTGCGG + Intergenic
949016612 2:241716089-241716111 ATTGCAATGAAGGCCGGGTGCGG - Intronic
1169369382 20:5016864-5016886 ACTGCGTTCATGGCCGGGTGAGG + Intergenic
1169603945 20:7293991-7294013 AATGTATTGTCGGCCGGGCGCGG - Intergenic
1172078432 20:32317929-32317951 ACAGTATTGTGGGCTGGGTGTGG - Intronic
1172704654 20:36874103-36874125 ACTGTGTGGTCGGCCGGGCGCGG + Intergenic
1173516769 20:43669833-43669855 ACAGCATTGGAGGCTGGGTGTGG + Intronic
1173592967 20:44239856-44239878 ACTGCATGGCAGGCCAGGTGTGG + Intergenic
1173642181 20:44611342-44611364 AAGGCATTCTAGGCCGGGTGCGG - Intronic
1174313062 20:49674449-49674471 ACTGCATTTAGGGTCGGGTGTGG + Intronic
1174366256 20:50058317-50058339 AGTGCACTCTCGGCCGGGCGTGG - Intergenic
1174793047 20:53498038-53498060 ACTGCCTGGGGGGCCGGGTGTGG - Intergenic
1178892945 21:36535098-36535120 AATGCTTTGTGGGCTGGGTGTGG + Intronic
1179318392 21:40267604-40267626 TCTGGATTATGGGCCGGGTGTGG + Intronic
1180926650 22:19559723-19559745 ACTGCAGTGTTGAGCGGGTGTGG - Intergenic
1181563503 22:23719358-23719380 ACTTTATGGTCGGCCGGGCGCGG - Intergenic
1182328733 22:29534976-29534998 AAAGCATTTTAGGCCGGGTGTGG + Intronic
1182514099 22:30843072-30843094 ACTGAATTGCAGGCCGGGTGCGG - Intronic
1182768797 22:32778580-32778602 AATGCAGTCTTGGCCGGGTGCGG - Intronic
1183373481 22:37448887-37448909 ACTGCACTGACAGCCGGGAGCGG - Intergenic
1183572019 22:38660483-38660505 GATGCATTTTCGGCCTGGTGTGG - Intronic
1183826147 22:40389307-40389329 ACTGCAGTGCAGGCCGGGCGCGG + Intronic
1183858236 22:40650880-40650902 ACTGCACTGTTGGCCGGGCGCGG - Intergenic
1183970806 22:41476115-41476137 AAAGCATTGTGAGCCGGGTGTGG + Intronic
950977411 3:17262769-17262791 AATACATTGTCGGCCGGGTGTGG - Intronic
951048938 3:18072700-18072722 AGTGCACTGTCGGCTGGTTGTGG - Intronic
952143991 3:30511615-30511637 ATGGCATTCTCGGTCGGGTGTGG - Intergenic
952768808 3:36978397-36978419 AATGAATTATTGGCCGGGTGCGG + Intergenic
953585186 3:44193691-44193713 ACTCCATTTTAGGCTGGGTGCGG - Intergenic
954044710 3:47919596-47919618 TTTGCGTTGTCGGCCGGGCGCGG - Intronic
954251271 3:49369311-49369333 AGTGAATACTCGGCCGGGTGTGG - Intronic
954337786 3:49929784-49929806 CCTGCACCGGCGGCCGGGTGAGG - Exonic
954415596 3:50391780-50391802 ACTGCACCATCAGCCGGGTGTGG - Intronic
954503234 3:51041505-51041527 AATACATTTTGGGCCGGGTGCGG - Intronic
955159092 3:56446915-56446937 AATGCACTCTCGGCCGGGTGTGG - Intronic
955329177 3:58032775-58032797 ACTGCTTTATTGGCTGGGTGTGG + Intronic
956504450 3:69922508-69922530 AAAGCAATGGCGGCCGGGTGTGG - Intronic
960534142 3:118798094-118798116 AGTGCAGTGTTGGCCGGGTATGG - Intergenic
961989133 3:131168644-131168666 AATGCAACGTCGGCCGGGCGCGG - Intronic
963090985 3:141483844-141483866 ACTTTATTTTCGGCCGGGCGCGG + Intergenic
965534432 3:169810772-169810794 GCTGCATTTCCGGCCGGGTGCGG + Intronic
965765692 3:172127946-172127968 GCTGTATCCTCGGCCGGGTGTGG - Intronic
966112532 3:176419818-176419840 AATTTATTGTCGGCCGGGCGCGG - Intergenic
966408406 3:179623380-179623402 ACTGTTTGGTAGGCCGGGTGCGG + Intronic
967019114 3:185507080-185507102 AATCCATTTTTGGCCGGGTGTGG + Exonic
967028486 3:185584842-185584864 ACAGCATTCCAGGCCGGGTGTGG - Intronic
968061968 3:195732648-195732670 ACTGGCTTCCCGGCCGGGTGCGG - Intronic
968127672 3:196171731-196171753 ACTGCAATGTGGGCCAGGTGCGG - Intergenic
968199922 3:196743555-196743577 ACTGCCTTCTAGGCCGGGTGCGG + Intronic
968314298 3:197709876-197709898 ACTGCAGAGTAGGCTGGGTGTGG + Intronic
968458548 4:711745-711767 ATTACATTTTCGGCCGGGTGCGG - Intronic
968702930 4:2065265-2065287 CCTGCAGTGTGGGCAGGGTGGGG + Exonic
968786980 4:2629839-2629861 TGTGCATTATCGGCCGGGTGCGG + Intronic
969496322 4:7528352-7528374 TTTGCATTGTCTGCAGGGTGAGG + Intronic
972148029 4:36053292-36053314 ACTGCATGCTGGGCCGGGCGCGG - Intronic
972596548 4:40534642-40534664 AATGCAAACTCGGCCGGGTGCGG + Intronic
973027678 4:45293241-45293263 ACTGCAATGGCGGTCTGGTGGGG + Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975129276 4:70816431-70816453 ACTCCAATGACGGCTGGGTGTGG + Exonic
975461556 4:74659419-74659441 AAAGGATTGTAGGCCGGGTGTGG + Intergenic
975783008 4:77859261-77859283 AATGGATTCTCGGCCGGGCGTGG - Intergenic
976005802 4:80428827-80428849 AATGCAATGTTGGCCTGGTGTGG - Intronic
976411324 4:84716504-84716526 AATACATTTTCGGCCGGGCGCGG + Intronic
977130739 4:93233631-93233653 ACCTCAGTGTCGGCTGGGTGTGG - Intronic
977768690 4:100831091-100831113 AATGTTTTGTCGGCCGGGCGCGG - Intronic
977958352 4:103056092-103056114 TCTGCATTATAGGCCAGGTGCGG - Intronic
978082520 4:104611949-104611971 ACTGAATTGGGGGCAGGGTGCGG - Intergenic
978811676 4:112856435-112856457 AGTGTATTATTGGCCGGGTGTGG + Intronic
979265355 4:118695819-118695841 AATGTATTTTGGGCCGGGTGCGG + Intronic
979359105 4:119740864-119740886 AATGCAGTTTCGGCCCGGTGCGG + Intergenic
980764793 4:137287697-137287719 AATGTATTGCAGGCCGGGTGCGG - Intergenic
980952161 4:139391747-139391769 ACAGCATTATTGGCTGGGTGCGG - Intronic
981072237 4:140555758-140555780 AAAGCATTTTAGGCCGGGTGTGG - Intergenic
981735749 4:147948664-147948686 AATGCATTGTAGGCCGGGCGCGG + Intronic
982030908 4:151299909-151299931 AAACCAATGTCGGCCGGGTGTGG + Intronic
982530815 4:156541057-156541079 CATAAATTGTCGGCCGGGTGCGG + Intergenic
983026779 4:162747384-162747406 ACTCAATAGTCGGCCGGGCGTGG - Intergenic
983070466 4:163261781-163261803 AATGCATTTTCAGCCGGATGTGG - Intergenic
983226725 4:165092410-165092432 ACAGCACTGTGGGCCGGGTGCGG - Intronic
983232548 4:165143724-165143746 ACAGTATTGGTGGCCGGGTGTGG - Intronic
983776524 4:171614868-171614890 ACTGCATTGTGTGGGGGGTGGGG - Intergenic
984628579 4:182036479-182036501 ATTAGATTATCGGCCGGGTGCGG - Intergenic
986600652 5:9469295-9469317 AATCCATTGCTGGCCGGGTGTGG - Intronic
987382043 5:17294612-17294634 ATGGCATGGTGGGCCGGGTGCGG + Intergenic
987605634 5:20132177-20132199 ACTTTATTGTTGGCCAGGTGTGG - Intronic
988556428 5:32240108-32240130 AATGAATTGTAGGCCGGGCGCGG + Intronic
988611577 5:32731949-32731971 AATCCATTCTCGGCCGGGCGCGG + Intronic
989161162 5:38393026-38393048 AAGGCATTGTGGGCCAGGTGCGG - Intronic
989319145 5:40114917-40114939 ATTCCATAGTCGGCCGGGCGCGG + Intergenic
989861422 5:46381398-46381420 ACTGCTCTATCGGCCGGGCGTGG - Intergenic
990401665 5:55444369-55444391 ACTGCATTTGGGGCCGGGCGCGG - Intronic
990707315 5:58543779-58543801 AGGGCATTATCGGCCAGGTGTGG + Intronic
991343982 5:65643526-65643548 ACTGCTGTTTCGGCTGGGTGGGG + Intronic
993179621 5:84535276-84535298 GCTGCACTATTGGCCGGGTGCGG - Intergenic
993277064 5:85873567-85873589 ACTGCATTGTAGTCCAGTTGAGG + Intergenic
994060422 5:95470266-95470288 ATTGAATTGTTGGCCGGGCGCGG - Intronic
994175032 5:96701968-96701990 ACTGCCTTGGCTGCCTGGTGGGG + Intronic
995195648 5:109364331-109364353 ATTTCAGTGTCGGCCGGGCGCGG + Intronic
995320099 5:110824398-110824420 ACTGGATTGGAGGCCAGGTGGGG - Intergenic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
997987384 5:138513492-138513514 ACAGTATGGTGGGCCGGGTGCGG - Intronic
998103799 5:139455684-139455706 ACTGCTATGTTGGCCTGGTGCGG + Intronic
998306141 5:141078810-141078832 ACTTCAGTGTCGGCCGGCAGTGG + Intergenic
998490192 5:142539887-142539909 ACTCCATTTTCGGCTGTGTGGGG + Intergenic
998577597 5:143333477-143333499 ACTGTATTGCTGGCCGGGCGCGG + Intronic
999258942 5:150226034-150226056 ATTGAATTCTCGGCCGGGTGCGG - Intronic
999315072 5:150578416-150578438 ACAGCAGTTTCGGCCGGGTGCGG + Intergenic
999734782 5:154505003-154505025 TCTTAATTGTAGGCCGGGTGCGG - Intergenic
1000018408 5:157298634-157298656 AATTGATTGTGGGCCGGGTGTGG - Intronic
1000081605 5:157853484-157853506 ACTGCTTTGTAGGCCGGGCACGG + Intronic
1000083375 5:157868052-157868074 ACTGCAGTGCCAGCAGGGTGAGG - Intergenic
1000339338 5:160265345-160265367 AATGCAATGCCGGCCAGGTGTGG + Intronic
1001993839 5:176138127-176138149 ACTTAGTTGTTGGCCGGGTGCGG - Intergenic
1002396645 5:178961523-178961545 ACAGCATTTTTGGCCAGGTGTGG + Intronic
1003835724 6:10070562-10070584 ATTACATTTTCGGCCGGGCGCGG + Intronic
1005013331 6:21356421-21356443 ACTGAATATTGGGCCGGGTGTGG - Intergenic
1006371392 6:33646124-33646146 AGTACATTTTCGGCCAGGTGTGG - Intronic
1006430599 6:33993386-33993408 GCTGCAGTGTCTGCAGGGTGGGG + Intergenic
1006531608 6:34659909-34659931 ACTGCCTTATGGGCCGGGCGTGG - Intronic
1006859904 6:37164674-37164696 CCAGCATTTTCGGCCGGGCGCGG + Intergenic
1007570493 6:42886703-42886725 ACTGTATTGCTGGCCGGGCGCGG + Exonic
1007591852 6:43026375-43026397 ACTGTCTTGGAGGCCGGGTGTGG + Intronic
1008787595 6:55188070-55188092 ACTGCATTTATGGCCGGGTGTGG - Intronic
1010603092 6:77855046-77855068 ACTGCATTTAGGTCCGGGTGTGG + Intronic
1010745906 6:79561168-79561190 AATGTATTGTTGGCCGGGAGTGG - Intergenic
1012222206 6:96662332-96662354 ACTGTGTTCTGGGCCGGGTGCGG - Intergenic
1013250773 6:108330995-108331017 ACTTCATTATAGGCTGGGTGTGG + Intronic
1015129617 6:129794634-129794656 ACTGCATAGTCTCCAGGGTGGGG + Intergenic
1015302395 6:131668502-131668524 ACTGCAATGTAGGCCGGGCACGG - Intronic
1016064375 6:139663888-139663910 ACTGAATTGTTGGTCGGGTGCGG - Intergenic
1016408551 6:143757462-143757484 ATTGCATTCTAGGCAGGGTGAGG + Intronic
1017436489 6:154420397-154420419 AATGCATTGGTGGCCGGGCGCGG + Intronic
1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG + Intergenic
1017747108 6:157456855-157456877 ACTGAGTTGTGGGCCGGGCGTGG + Intronic
1017863409 6:158421069-158421091 AATGCATTGGTGGCCGGGCGCGG + Intronic
1018014559 6:159700362-159700384 AATGCATTGTTGGCCAGGCGCGG + Intronic
1018246881 6:161832331-161832353 ACATCAATATCGGCCGGGTGGGG + Intronic
1018254624 6:161905668-161905690 AGTACATTTTCGGCCGGGTGTGG + Intronic
1018753596 6:166829299-166829321 AATGAATTATCGGCCGGGCGCGG + Intronic
1021448357 7:20757818-20757840 TTTAAATTGTCGGCCGGGTGTGG - Intronic
1021545862 7:21812381-21812403 AATGAACTGTCCGCCGGGTGTGG + Intronic
1021864459 7:24941107-24941129 AAAGCAATGTTGGCCGGGTGCGG - Intronic
1022336396 7:29425918-29425940 AGTGGACTGTGGGCCGGGTGTGG + Intronic
1022941083 7:35240038-35240060 AATGCATTTTTGGCCAGGTGCGG - Intronic
1023105029 7:36755660-36755682 AATTAATTGTGGGCCGGGTGTGG - Intergenic
1024479029 7:49844971-49844993 AGTGAATTGCCGGCCGGGTGCGG - Intronic
1024800653 7:53073697-53073719 AATACATTAGCGGCCGGGTGCGG + Intergenic
1025166242 7:56714827-56714849 AAAGCATTGCCAGCCGGGTGTGG - Intergenic
1025955128 7:66176950-66176972 AATGCTTTTTCGGCTGGGTGTGG - Intergenic
1026017996 7:66685986-66686008 ACCGCATTATAGGCCAGGTGCGG + Intronic
1026096270 7:67348847-67348869 AGTGCCTTGTGGGCCGGGCGCGG - Intergenic
1026250854 7:68669280-68669302 ACAACATTCTCGGCCGGGTGCGG - Intergenic
1026928870 7:74211880-74211902 CCTGCGCTGTTGGCCGGGTGCGG - Intronic
1027165269 7:75829774-75829796 GCTCCTGTGTCGGCCGGGTGTGG - Intergenic
1027490758 7:78823291-78823313 ACGACACTGTCGGCCGGGCGCGG + Intronic
1027590206 7:80110175-80110197 ATTGCATTATCGGCCGGGCACGG + Intergenic
1027651337 7:80872511-80872533 GCTGAATTCTCGGCCGGGCGTGG + Intronic
1029441262 7:100587886-100587908 AGTCCACTGTGGGCCGGGTGCGG - Intronic
1030186291 7:106765409-106765431 AAGGCAATGTGGGCCGGGTGTGG + Intergenic
1030606421 7:111643317-111643339 AGTCCATTTTGGGCCGGGTGTGG - Intergenic
1031824811 7:126550400-126550422 AATACTTTTTCGGCCGGGTGCGG - Intronic
1032010868 7:128347007-128347029 AATGCCTTGTAGGCCCGGTGTGG + Intergenic
1032302081 7:130696745-130696767 ATTGCATTTTGGGCCGGGTGTGG + Intergenic
1032827219 7:135582748-135582770 TCTGCATTATCAGCCAGGTGTGG - Intronic
1032888719 7:136170081-136170103 ACTGAGCTATCGGCCGGGTGCGG - Intergenic
1034103278 7:148469397-148469419 AGTGCATTTTTGGCCGGGTGCGG + Intergenic
1034171481 7:149066201-149066223 ACTGTGTTATCGGCCGGGCGCGG + Intergenic
1034616603 7:152423048-152423070 ACTACATTCCCAGCCGGGTGCGG + Intronic
1034838587 7:154374900-154374922 ACTATAATGTCGGCCGGGCGCGG - Intronic
1035982956 8:4393264-4393286 ACTGCTTTGTAGGCCAGGTGGGG - Intronic
1036511303 8:9402852-9402874 TCAGCATTGTCTGCTGGGTGAGG - Intergenic
1037514597 8:19618127-19618149 AGTGCTTTGTCGGGGGGGTGAGG - Intronic
1037550294 8:19964240-19964262 ACTGCATCTAGGGCCGGGTGTGG - Intronic
1037666084 8:20971423-20971445 ACTACATTGTTGGCCGGACGCGG + Intergenic
1039962899 8:42263301-42263323 AATGTGGTGTCGGCCGGGTGTGG - Intergenic
1040779260 8:51088469-51088491 ACATCAGTGTCGGCCGGGTGCGG + Intergenic
1041766140 8:61420307-61420329 AAAACATTGTTGGCCGGGTGCGG + Intronic
1042549976 8:69985576-69985598 ATTGCACTTTCTGCCGGGTGTGG - Intergenic
1043118458 8:76290053-76290075 ACTCCTTTATCGGCCGGGTGTGG - Intergenic
1044104321 8:88184034-88184056 ACTACATTTTGGGCCGGGCGCGG - Intronic
1045923507 8:107560985-107561007 AGTGTATTCTAGGCCGGGTGTGG - Intergenic
1047239676 8:123074308-123074330 ACTGATTTGTCGGCCAGGCGCGG - Intronic
1047554089 8:125909982-125910004 ACTGTAGTGTTGGCAGGGTGCGG + Intergenic
1047751930 8:127888321-127888343 TGTGCATTGTGGGCAGGGTGAGG + Intergenic
1049750979 8:144283825-144283847 AATGCATTGATGGCCAGGTGCGG + Intronic
1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG + Intergenic
1049858420 8:144879773-144879795 ACTGTATCCTTGGCCGGGTGCGG + Exonic
1050076858 9:1874814-1874836 ACTGCTTTCTTGGCCAGGTGTGG + Intergenic
1050315499 9:4397313-4397335 AATGGATTGACGGCAGGGTGTGG - Intergenic
1051270400 9:15349723-15349745 AATGGATTCTCGGCCAGGTGTGG - Intergenic
1051823889 9:21197678-21197700 AATGAAATGTCGGCCGGGCGCGG + Intergenic
1052307663 9:27029455-27029477 ACAATATAGTCGGCCGGGTGTGG + Intronic
1053874915 9:42534562-42534584 AATGCAGTGTCTGCCGGGCGCGG + Intergenic
1056335145 9:85561079-85561101 AGACCATTTTCGGCCGGGTGTGG + Intronic
1057993405 9:99797110-99797132 ATTACATTGACGGCCGGGCGCGG + Intergenic
1058860750 9:109115818-109115840 AGTGGATTGTAGGCCAGGTGCGG - Intronic
1058882043 9:109294014-109294036 AAATCATTGTTGGCCGGGTGTGG + Intronic
1059979175 9:119750921-119750943 ACTGGATGCTGGGCCGGGTGCGG + Intergenic
1060209234 9:121699869-121699891 AAGGCATTTTCGGCCGGGTTTGG + Intronic
1061271030 9:129542757-129542779 ACAGGATTGTTGGCTGGGTGTGG - Intergenic
1062202879 9:135315742-135315764 ACCACACTGTCGGCCAGGTGCGG - Intergenic
1185765066 X:2718657-2718679 ACAGCATTGAGGGCTGGGTGTGG - Intronic
1185937350 X:4273774-4273796 AGTGCAATGTGGGCCAGGTGTGG + Intergenic
1186463148 X:9764734-9764756 ACTACCTAGTCGGCCGGGCGCGG + Intronic
1187357844 X:18594890-18594912 AATACATAGACGGCCGGGTGTGG + Intronic
1187679491 X:21752805-21752827 ACAGCATAGTAGGCCGGGCGCGG - Intronic
1187901648 X:24031872-24031894 AATGCAGTGATGGCCGGGTGCGG + Intergenic
1188413224 X:29899832-29899854 AATTCACTGTTGGCCGGGTGTGG - Intronic
1188501636 X:30833257-30833279 ATGGCATAGTAGGCCGGGTGCGG - Intronic
1188563690 X:31499781-31499803 ACTGAATTCCCGGCTGGGTGTGG - Intronic
1188789330 X:34388746-34388768 ATTGCATTTTTGGCCAGGTGGGG + Intergenic
1189269601 X:39741673-39741695 ACTACATTCCTGGCCGGGTGCGG - Intergenic
1189399976 X:40658380-40658402 ACTGAAGTGCAGGCCGGGTGCGG - Intronic
1189442584 X:41050291-41050313 ACTACATTTTCAGCCAGGTGCGG - Intergenic
1190142720 X:47862235-47862257 AGTACAATCTCGGCCGGGTGCGG + Intronic
1190294352 X:49016287-49016309 ACCAGGTTGTCGGCCGGGTGCGG + Intergenic
1192783215 X:74314768-74314790 ACACAATTGTCGGCCGGGCGCGG - Intergenic
1193426905 X:81350292-81350314 ACTGTAATGTCGGCCGGGCGCGG - Intergenic
1194036098 X:88874155-88874177 TTTGCATTTTGGGCCGGGTGCGG - Intergenic
1195238186 X:102923021-102923043 ACTACATTTTTGGCTGGGTGTGG - Intergenic
1195391913 X:104371027-104371049 TCTCCATTGCAGGCCGGGTGCGG - Intergenic
1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG + Intronic
1195813067 X:108855334-108855356 ACTGTCTGGTCGGCCGGGTGCGG - Intergenic
1196213244 X:113019975-113019997 ATTGAATTGTCAGCCAGGTGTGG - Intergenic
1196292176 X:113955685-113955707 AATGATTTGTAGGCCGGGTGTGG + Intergenic
1196797996 X:119517785-119517807 ACTGTATTGCTGGCCGGGCGTGG - Intergenic
1197806779 X:130405086-130405108 ACTACTTTGTTGGCTGGGTGCGG + Intronic
1198150386 X:133902952-133902974 ACACCATTTTAGGCCGGGTGCGG + Intronic
1198238164 X:134756557-134756579 ATTACATTTTCGGCCGGGCGCGG + Intronic
1198522699 X:137468949-137468971 ACTGGATTATCGGCCGGGTGAGG - Intergenic
1198582880 X:138086093-138086115 ACTACATTCTTGGCCGGGCGTGG - Intergenic
1199336940 X:146629397-146629419 ATTCCTTTCTCGGCCGGGTGCGG - Intergenic
1200112868 X:153751394-153751416 ACTTCACTGTGGGCCGGGTGCGG - Intergenic
1200171856 X:154082540-154082562 AAAGCATTTTCGGCCGGGTGTGG - Intronic
1201192013 Y:11452673-11452695 TCTCCTTTGTCGGCCGGGCGCGG + Intergenic