ID: 974867903

View in Genome Browser
Species Human (GRCh38)
Location 4:67603183-67603205
Sequence GAGTGAACATCAGTGGTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 9, 3: 25, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974867903_974867912 27 Left 974867903 4:67603183-67603205 CCGGCTACCACTGATGTTCACTC 0: 1
1: 1
2: 9
3: 25
4: 154
Right 974867912 4:67603233-67603255 GTGGTGAATACTGCCAGGCCTGG 0: 5
1: 88
2: 308
3: 584
4: 866
974867903_974867910 8 Left 974867903 4:67603183-67603205 CCGGCTACCACTGATGTTCACTC 0: 1
1: 1
2: 9
3: 25
4: 154
Right 974867910 4:67603214-67603236 AGGGCTCTTCAATCAGTTTGTGG 0: 4
1: 19
2: 177
3: 370
4: 754
974867903_974867911 22 Left 974867903 4:67603183-67603205 CCGGCTACCACTGATGTTCACTC 0: 1
1: 1
2: 9
3: 25
4: 154
Right 974867911 4:67603228-67603250 AGTTTGTGGTGAATACTGCCAGG 0: 2
1: 37
2: 284
3: 468
4: 635
974867903_974867913 28 Left 974867903 4:67603183-67603205 CCGGCTACCACTGATGTTCACTC 0: 1
1: 1
2: 9
3: 25
4: 154
Right 974867913 4:67603234-67603256 TGGTGAATACTGCCAGGCCTGGG 0: 4
1: 107
2: 338
3: 638
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974867903 Original CRISPR GAGTGAACATCAGTGGTAGC CGG (reversed) Intronic
900843388 1:5076297-5076319 GAGGAAACATCAGGGGTAGGGGG - Intergenic
903919195 1:26787673-26787695 CAGTGAACGTCAGCGGGAGCTGG + Intronic
906336184 1:44933715-44933737 GAGATAACATCAGTGGTAAGTGG - Intronic
908427182 1:64018466-64018488 GTGTGATCATCAGTGGGAGAAGG - Intronic
911975597 1:104490018-104490040 GAGTGAACATAGGTGGTAGCTGG + Intergenic
912604791 1:110978897-110978919 GTGTAAAGATCAGTGGTTGCTGG + Intergenic
913207371 1:116552723-116552745 GAGTGTTCATCAGTGGTGGATGG - Intronic
914318764 1:146539445-146539467 GATTCAACATAAGTGGAAGCAGG - Intergenic
914495594 1:148193912-148193934 GATTCAACATAAGTGGAAGCAGG + Intergenic
915092886 1:153438892-153438914 GCGTGGACATGAGTGTTAGCAGG + Intronic
916221176 1:162446408-162446430 GAGTGGACATCAATGGGACCAGG + Intergenic
917931464 1:179825520-179825542 GAGTGAAAAACAGTGGCAGCTGG + Intergenic
922539579 1:226408560-226408582 GCGTGAAGATCACTTGTAGCAGG - Intergenic
1068071981 10:52207086-52207108 GACTGCACATCATTGGGAGCAGG + Intronic
1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG + Intronic
1069980886 10:72251738-72251760 GAGTGACCATGAGCTGTAGCTGG - Intergenic
1070113036 10:73502989-73503011 AAGTAAACATCAGTGGGAGTTGG - Intronic
1072763363 10:98076699-98076721 GAGTGAATATCAGTGATGGGGGG + Intergenic
1074270100 10:111945181-111945203 CAGAGAACATCAGTGGGAGTGGG - Intergenic
1075222507 10:120597368-120597390 AAGTGATCCTCAGAGGTAGCTGG - Intergenic
1075810586 10:125222095-125222117 GAGTGAAAATCAGATGTGGCGGG - Intergenic
1078213306 11:9289617-9289639 AAGTGAAGATGAGCGGTAGCTGG - Intronic
1081073675 11:38642165-38642187 GAGTGAGCATCAGCAGTTGCTGG - Intergenic
1084763810 11:71294479-71294501 GAGTGAACATCAGCAGTAGCTGG - Intergenic
1085491518 11:76923356-76923378 GAAAGAAGATCAGTGGTTGCTGG - Intronic
1086071927 11:82809189-82809211 AAGTAAACATCATCGGTAGCAGG + Intergenic
1087331287 11:96783837-96783859 GAGTGACTATCAGTGCTGGCTGG + Intergenic
1091229553 11:133979118-133979140 GAGTGAACCTCCTTGGAAGCAGG + Intergenic
1094419821 12:30258473-30258495 AAGTGAACATCAGCAGTAGCTGG + Intergenic
1094766699 12:33604206-33604228 GAATGAACATCAGTGAAATCTGG + Intergenic
1095159185 12:38896404-38896426 GAGTGAACATCATTGGTCCCTGG + Intronic
1095961190 12:47835206-47835228 CTGTGAACATCTGTGGCAGCCGG - Intergenic
1096515184 12:52151831-52151853 GAGTGGGCGTCAGGGGTAGCAGG + Intergenic
1096551994 12:52379009-52379031 GAGTGAACATCATGGATGGCAGG - Intronic
1100175010 12:92020104-92020126 AAGTGTACATCACTGGTAGGTGG - Intronic
1101651002 12:106677049-106677071 GAGGGAATATCAGTGGAACCTGG + Intronic
1102956573 12:117062937-117062959 CAGTGACCATCAGGGGTAGCGGG + Intronic
1103333542 12:120171827-120171849 GAATGACCATCAGTTGTAGGTGG - Intronic
1107005727 13:35608953-35608975 GAGATAATATCAGAGGTAGCTGG - Intronic
1110951284 13:81494992-81495014 GATTGAACATCAGTCTTAGAGGG - Intergenic
1111396191 13:87672296-87672318 GAGTGATCATGAGTGTGAGCGGG + Intergenic
1114751793 14:25212446-25212468 GAGTGAAAATCTGTGGGAGTGGG + Intergenic
1116086960 14:40253299-40253321 AAGAGAACATAGGTGGTAGCTGG - Intergenic
1116434091 14:44877424-44877446 TAATGAACATCAGTGGTAGCCGG + Intergenic
1117572605 14:57062664-57062686 CCCTGAACATCAGTGTTAGCTGG - Intergenic
1119118669 14:72052342-72052364 GAATGAACATAAGTGGTAGCAGG + Intronic
1121928050 14:97947287-97947309 GAGTCACCATCAGTGGCACCTGG - Intronic
1126716773 15:51525944-51525966 GAGAGAACATAGGTGGTAGCTGG + Intronic
1127112437 15:55688996-55689018 GAGTTAAAATCAGTGGGAACAGG - Intronic
1129004309 15:72359304-72359326 GAGTGAGCTGCAGAGGTAGCAGG - Intronic
1133135080 16:3705403-3705425 GAGTGAACATGAGTGGCTGTAGG - Intronic
1133650398 16:7807255-7807277 GAGTGACCAACTGTGCTAGCTGG + Intergenic
1136679305 16:31946346-31946368 GAGTGAACATAGGTGGTAGCCGG + Intergenic
1138863200 16:60784986-60785008 GAGTGCAGATCAGTGGTGCCTGG + Intergenic
1144515294 17:15913331-15913353 GAATGACCATCAGTGGGAGCTGG - Intergenic
1148027648 17:44599774-44599796 GAGTGAGCAGGAGTGGAAGCAGG + Intergenic
1149111218 17:53033228-53033250 AAGTGAACATAGGTGGTAGCTGG - Intergenic
1152551070 17:81030559-81030581 GAGTGACCATCTGTGTTGGCTGG + Intergenic
1156794237 18:41022611-41022633 CAGTGAAAATCAGTTGCAGCTGG - Intergenic
1158116846 18:54005344-54005366 GAATAAACATCAGTGGTATATGG + Intergenic
1159225165 18:65523802-65523824 AAGTGAACATCAGTGGTAACCGG + Intergenic
1159903780 18:74072246-74072268 GAGTGAGCATCAGGGGAAGAAGG - Intergenic
1160413330 18:78689197-78689219 GAGTCCACATCAGTGCTGGCTGG - Intergenic
1160564757 18:79780143-79780165 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564778 18:79780248-79780270 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564799 18:79780353-79780375 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1160564820 18:79780458-79780480 CTGTGAACATCAGTGCTGGCCGG + Intergenic
1163063971 19:14779559-14779581 GAGTGAACACCAGCAGAAGCTGG + Intergenic
1163185450 19:15635949-15635971 GAATAATCATCAGTGGTAGCTGG - Intronic
1167879631 19:52445169-52445191 GAGTGAAAAACAAGGGTAGCGGG - Intronic
926426956 2:12746898-12746920 GAGTCAACAGCAGTGGGAGATGG + Intergenic
927871057 2:26624063-26624085 GAGAGAACATCCTGGGTAGCAGG - Intronic
931580986 2:63774253-63774275 GACTGAAAATCAGTGGAATCAGG + Intronic
931656715 2:64516062-64516084 GAGGCAATATCAGTGGCAGCTGG + Intergenic
932921054 2:75916118-75916140 GAGTGAACATAGGTGGCAGCCGG - Intergenic
933177974 2:79197292-79197314 GAGTGAACAAAAGTGGTAAGGGG + Intronic
933320789 2:80773379-80773401 CAGTTAACATCTGAGGTAGCAGG - Intergenic
933987574 2:87604630-87604652 GAGTGAACCTCGGCTGTAGCTGG - Intergenic
934929028 2:98405042-98405064 GAGTGAACATCATAGGCAGTAGG + Intergenic
934929085 2:98405367-98405389 GAGTGAATATAGGTGGTAGCCGG + Intergenic
936306266 2:111346178-111346200 GAGTGAACCTCGGCTGTAGCTGG + Intergenic
941918775 2:170829051-170829073 GAGAGAACAGCAGAGGTAGGAGG - Intronic
942862828 2:180636380-180636402 AAGTGAATATCAGTGGTGCCTGG + Intergenic
948239343 2:236416527-236416549 CAGTGAACATCAGTGGAACGTGG + Intronic
1168787640 20:553573-553595 AAGTGAACATCACCAGTAGCAGG + Intergenic
1169368102 20:5007701-5007723 GAGTGAAGATTAGTGGTTGCCGG - Intronic
1171570162 20:26242111-26242133 GAGAGAATATCAGTGTAAGCAGG - Intergenic
1172108206 20:32529091-32529113 GAGTGGTCATAAGTGGCAGCTGG + Intronic
1172605953 20:36214232-36214254 GAGTGAACATCACTGGCAGGGGG - Intronic
1174953847 20:55074319-55074341 GAGTGAAAATCAGGTGTGGCAGG + Intergenic
1175632138 20:60550223-60550245 GAGTGAACATCAGTGTAGCCAGG - Intergenic
1176995726 21:15553044-15553066 TAGTGGCCTTCAGTGGTAGCTGG - Intergenic
1177279859 21:18967006-18967028 CAGAGAACATCAGTGGGAGATGG + Intergenic
1177578039 21:22983404-22983426 GAGTGAACATAGTTGGTAGCCGG + Intergenic
1177736832 21:25101473-25101495 GAAAGAAAAGCAGTGGTAGCAGG + Intergenic
1178293670 21:31390760-31390782 GGGTGAACATCAGTGTTTCCTGG - Intronic
1180855695 22:19043399-19043421 GAGATGACATGAGTGGTAGCAGG + Intronic
1180952777 22:19728245-19728267 GAGTGGACCTCAGGGGTTGCAGG + Intergenic
1184195437 22:42924600-42924622 GGGTGGACAGCAGTGGTGGCGGG - Intronic
1184640902 22:45869473-45869495 GTGTGAGCATGTGTGGTAGCAGG - Intergenic
953102714 3:39845311-39845333 GTGTGAAGTTCAGTGGCAGCTGG + Intronic
956178656 3:66498689-66498711 TAGTGAAAATCAGTGGTCGTAGG - Intronic
956283642 3:67585636-67585658 AAGGGAACATGAGTGGTAGCTGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959792108 3:110374203-110374225 GAGTGAATATGTTTGGTAGCAGG + Intergenic
960025966 3:113009847-113009869 GACAGAACATCAATGGAAGCTGG + Intronic
960048893 3:113222191-113222213 GACTGAAGATCAGTGGAATCAGG + Intronic
962400449 3:135054633-135054655 GAGCTAACATCCGTGCTAGCTGG - Intronic
962559676 3:136592369-136592391 GAGAGAAAATGAGTGCTAGCAGG - Intronic
962581775 3:136804460-136804482 GAGTAAACATCAGGGGAAACAGG - Intergenic
966307275 3:178550677-178550699 GAAGGAACATCAGTATTAGCAGG + Intronic
968320158 3:197760252-197760274 GAGTGTTCTTCAGTGGTAGAAGG + Intronic
974867903 4:67603183-67603205 GAGTGAACATCAGTGGTAGCCGG - Intronic
976161297 4:82201929-82201951 GAATAAATACCAGTGGTAGCTGG + Intergenic
976602212 4:86948550-86948572 GAGTCAACAGCAGTGGCAACAGG + Exonic
979551890 4:122000478-122000500 GAGAGAAAATCAGTGGTATGGGG - Intergenic
979913102 4:126395967-126395989 GAATAAATATCAGTGCTAGCTGG - Intergenic
980981563 4:139658633-139658655 AAGTGAGCATCAGTGGTGCCAGG - Intergenic
982550141 4:156787525-156787547 GAGACAACATGCGTGGTAGCTGG + Intronic
982828206 4:160026996-160027018 GAGTGAAAATAGATGGTAGCTGG - Intergenic
983122927 4:163910957-163910979 GAATGAATATCAGTAATAGCAGG + Intronic
985990581 5:3557172-3557194 GAGTGAAAATCAATCGGAGCTGG + Intergenic
986631077 5:9774928-9774950 GAGTGAATATTGGTGGTAGCTGG - Intergenic
987645912 5:20672227-20672249 GAGTGAAAATCAGCAGTATCTGG + Intergenic
987903917 5:24051005-24051027 GAGTGAACATCAGTGTGGCCAGG + Intronic
988710459 5:33769226-33769248 GAGTCAAAATCAGTGTTGGCAGG - Intronic
989738445 5:44738166-44738188 CAGTGCCCATCAATGGTAGCTGG - Intergenic
992066256 5:73112907-73112929 GAGTGAAGGACAGTTGTAGCAGG + Intergenic
992262396 5:74984532-74984554 GAGGGAACATCAGGGGTAAGGGG + Intergenic
992345287 5:75869653-75869675 GAGTAAACATAGGTGGTAGCCGG + Intergenic
992842994 5:80714729-80714751 GAGTGAACACAAGAGGCAGCTGG - Intronic
993138387 5:83998776-83998798 GAATAAACCTCAGTGGTACCAGG + Intronic
995176339 5:109182290-109182312 GGGTTAGCATCTGTGGTAGCTGG - Intronic
996166328 5:120228534-120228556 GAGTGAACATAGGTGGTAACAGG - Intergenic
1001243157 5:170085564-170085586 AAGGGAACATCGGTGGTACCAGG - Intergenic
1004618339 6:17311643-17311665 GAGTGAATAGCAGAGGTATCAGG - Intergenic
1004871719 6:19911687-19911709 GAGTTGACATCAGTGTAAGCTGG - Intergenic
1006026936 6:31152934-31152956 GTGTGAAGTCCAGTGGTAGCTGG - Intronic
1006039154 6:31239413-31239435 GAGTGACCAACACTGGGAGCTGG + Intergenic
1006867812 6:37222992-37223014 CAGTGGACATAAATGGTAGCAGG + Intronic
1006886528 6:37386665-37386687 AAGTGAAAATCAGTGGTTGCTGG + Intronic
1010002942 6:70966572-70966594 GAGGAAACATCAGGGGTAGAAGG - Intergenic
1010627227 6:78153298-78153320 GGGTGAACATCAGTGGTTTCTGG + Intergenic
1012199757 6:96391479-96391501 CAGTTAACATCACTGGTAACAGG + Intergenic
1013018646 6:106186584-106186606 GAGTGAACATCTGAGCTACCCGG - Exonic
1015349818 6:132204506-132204528 AAGTGCCCATCAGTGGTGGCTGG - Intergenic
1018199408 6:161381293-161381315 GAGTGGTCATCAGTGCTGGCTGG + Intronic
1018831708 6:167448578-167448600 GGGTGACCATCAGTGGCAGGTGG - Intergenic
1019581798 7:1767873-1767895 GAGTGAATATCAGTGGGCACTGG - Intergenic
1022022455 7:26413894-26413916 GAGAGAAGATCAGTGCTGGCAGG - Intergenic
1022223498 7:28339634-28339656 GAGTGAACATAGGTGGTAGCTGG - Intronic
1022437202 7:30399840-30399862 GAGAACACATCAGTGGTTGCTGG - Intronic
1022484021 7:30764073-30764095 GAGTGAGCATCAGAAGTACCTGG + Intronic
1022600145 7:31750191-31750213 GAGTGAAGGGCAGTGGTTGCAGG + Intergenic
1022950510 7:35333703-35333725 GAGAGAAAAACACTGGTAGCTGG + Intergenic
1023218110 7:37886975-37886997 GAATCCACATCAGTGTTAGCAGG + Intronic
1025800171 7:64779757-64779779 GAGAGATTATCAGTGGTAGCAGG - Intergenic
1025878449 7:65509393-65509415 GAGCGAAAAGCAGTGGGAGCTGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1027995926 7:85424922-85424944 GAGTTAAGATCAGGGGTTGCTGG - Intergenic
1028022450 7:85793071-85793093 GAGTGAACATTAGTGGTAGCCGG + Intergenic
1028266538 7:88733319-88733341 GAGTGAACATCAGTGACAGCTGG - Intergenic
1030228702 7:107181806-107181828 GTGTGTGCATGAGTGGTAGCTGG + Intronic
1032315626 7:130835938-130835960 CCTTGAACTTCAGTGGTAGCAGG - Intergenic
1035311981 7:157975203-157975225 GAGTGGACAGCAGTGTTGGCAGG - Intronic
1036763029 8:11525689-11525711 GAGGGCACATGAGTGGTGGCAGG - Intronic
1038021871 8:23557769-23557791 TAGTGAATGTCAGTGCTAGCTGG + Intronic
1041852696 8:62410349-62410371 AAGTGCCCATCAGTGGTAGATGG - Intronic
1048567290 8:135614971-135614993 GAGGAAACATCAGTGGTAGGGGG + Intronic
1048918706 8:139208215-139208237 GAATGCACATCATTGGCAGCAGG + Intergenic
1049277212 8:141725869-141725891 GTGGCAACAGCAGTGGTAGCCGG - Intergenic
1052607530 9:30723624-30723646 GAGAAAACATAGGTGGTAGCCGG + Intergenic
1055338281 9:75255221-75255243 GTGAGAAAGTCAGTGGTAGCTGG + Intergenic
1056682029 9:88727827-88727849 TATTGATCATCAGTGGTAGGTGG + Intergenic
1058811140 9:108640732-108640754 CAGTAAACATCAGTGTTACCTGG + Intergenic
1062208782 9:135351914-135351936 GAGGGAGCATCTGTGGTAGCCGG - Intergenic
1186074782 X:5866259-5866281 TCGTGAACATCAGTGGAAGCTGG - Intronic
1187012035 X:15289315-15289337 GAGTTAACATCAAAGGAAGCAGG + Intronic
1188938919 X:36213364-36213386 GGATGTACATCAGTGGTACCTGG + Intergenic
1189235847 X:39486522-39486544 AATTGAAAATAAGTGGTAGCAGG + Intergenic
1190507837 X:51145291-51145313 GAATAAACATCAGTGGTAGCCGG - Intergenic
1192397326 X:70795169-70795191 CAGTGAACATCAGTGGAGCCTGG + Intronic
1193344412 X:80388402-80388424 GATTAATCAGCAGTGGTAGCTGG - Intronic
1193563314 X:83047157-83047179 GAGTGAACACAGATGGTAGCAGG - Intergenic
1196214468 X:113034873-113034895 AAGGGAACATAAGTGGTAGTTGG - Intergenic
1196963382 X:121028317-121028339 GAGTGAACAGCTGAGGTAGGGGG + Intergenic
1197016030 X:121627080-121627102 GAGTAAACATCAGCAGTAGCTGG + Intergenic
1197829885 X:130630327-130630349 GAGTTAAGATGAGTGGTAGCTGG + Intronic
1198172052 X:134116727-134116749 GAGAGTACATTAGTGGTTGCTGG - Intergenic
1199795139 X:151188052-151188074 GAGTGAACATTAATGGTTTCAGG - Intergenic