ID: 974870205

View in Genome Browser
Species Human (GRCh38)
Location 4:67633302-67633324
Sequence ATTAAGAAAAGGTCTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974870205_974870207 4 Left 974870205 4:67633302-67633324 CCAAGATCAGACCTTTTCTTAAT 0: 1
1: 0
2: 0
3: 22
4: 212
Right 974870207 4:67633329-67633351 CACAATGCATACTTACCTTATGG 0: 1
1: 0
2: 1
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974870205 Original CRISPR ATTAAGAAAAGGTCTGATCT TGG (reversed) Intronic
903251472 1:22056886-22056908 CTTAAGACAAAGTCTGATTTAGG + Intronic
904608604 1:31712862-31712884 ATCAAGAAAGGGTGTGATCCTGG + Intergenic
906889824 1:49697603-49697625 AGTAAGAAAAGCTTTCATCTAGG + Intronic
907957140 1:59240605-59240627 ATTAACACAAGGACTAATCTCGG - Intergenic
908059216 1:60328864-60328886 AATAAGAAAAATTATGATCTGGG - Intergenic
908775603 1:67637037-67637059 ATTAACAAAAGTTATGGTCTAGG + Intergenic
909824809 1:80114683-80114705 TTTAATAAAGGGTTTGATCTGGG + Intergenic
912765462 1:112405591-112405613 ATTAAAAACAGGTCTGGGCTGGG - Intronic
914374363 1:147060774-147060796 ATGAAGAAAAGCTCTGATATGGG - Intergenic
915734265 1:158074871-158074893 GTTAGGAAAAGGTCAGATTTGGG + Intronic
916307310 1:163352014-163352036 GTGAAGAAAAGGTCAGATGTGGG - Intronic
917711125 1:177686677-177686699 ATCGAGAAATGGTCTGTTCTTGG - Intergenic
920580646 1:207104311-207104333 ATTATGATAAACTCTGATCTGGG + Exonic
921724093 1:218505488-218505510 AGTTAGAAAAGGTCTGATAAGGG + Intergenic
922435582 1:225602259-225602281 ATTAAAAAAAGGTCTCATCACGG - Intronic
924229781 1:241953792-241953814 ATTAAGAAGAGGACTGAGCTTGG - Intergenic
1063236096 10:4117999-4118021 ATTATGAAACTTTCTGATCTCGG + Intergenic
1063519641 10:6729417-6729439 ATTTAGAAAGAGTCAGATCTGGG + Intergenic
1065601408 10:27372832-27372854 ATTTAGAAAATGTCTGATTAAGG + Intergenic
1067546972 10:47199141-47199163 ATCAAGAAACAGTCTGATTTTGG - Intergenic
1068276269 10:54802141-54802163 ATTAAGAAAACATGTGTTCTGGG - Intronic
1068849297 10:61718231-61718253 ATGAAGCAAAGGTCAGATTTTGG + Intronic
1069576258 10:69531090-69531112 ATGAAGTAAAGAGCTGATCTAGG + Intergenic
1072014351 10:91331745-91331767 ATTTATTAAATGTCTGATCTTGG + Intergenic
1072925708 10:99614758-99614780 CTTCAGAAAAGGTCTAATTTAGG - Intronic
1073736930 10:106359024-106359046 ACCCAGTAAAGGTCTGATCTTGG - Intergenic
1074084702 10:110200568-110200590 GTTAAAAAAAGGTCTTCTCTTGG - Intergenic
1075183126 10:120230007-120230029 ATGAAGAAAAGGACTGCTATGGG - Intergenic
1075451411 10:122554243-122554265 CTTAAGGACAGGTCTGATTTGGG + Intergenic
1079662149 11:23052446-23052468 ATTAAGAAATGGTCTGGGCGTGG + Intergenic
1080438122 11:32265092-32265114 ATTAAGAAAAGGTCTTCGCCGGG + Intergenic
1081786881 11:45754037-45754059 AGTTAAAAAAGGTCAGATCTTGG - Intergenic
1081930325 11:46865801-46865823 AATAAGAAAAGGTCCGAGCGGGG + Intronic
1082736805 11:56865201-56865223 ATTCAGAAGAGGGCTGATCAAGG + Intergenic
1084157017 11:67318837-67318859 ATTAAGAAAAGGTCTTATGGTGG - Intronic
1084255200 11:67937064-67937086 ATTCAGAAATGGTTTGATCAAGG + Intergenic
1084817722 11:71659527-71659549 ATTCAGAAATGGTTTGATCAAGG - Intergenic
1085230616 11:74966287-74966309 ATTAGGAAAGGATCTGATTTTGG + Intronic
1086810532 11:91304756-91304778 CCTAAGAAAAGGTCTAATCTCGG + Intergenic
1088456627 11:110039595-110039617 ATTCAGAATAGGGCTGACCTCGG + Intergenic
1089226163 11:116924376-116924398 ATTAAGAAAATTTTTAATCTTGG + Intronic
1092669273 12:10844349-10844371 ATTAACAAAATATCTTATCTTGG + Intronic
1093379738 12:18478130-18478152 TTTAAAAAAAGGACTGAGCTGGG + Intronic
1093509186 12:19905722-19905744 ATTAAGAAAGAGTATGAGCTGGG + Intergenic
1093661298 12:21760357-21760379 ATTAAAAAAAGGAGTGATTTAGG + Intergenic
1093663377 12:21783475-21783497 AAAATGAAAAGGTCTGAACTAGG - Intergenic
1093814643 12:23530344-23530366 ATTAAGAAAATATCTGAAGTTGG + Intronic
1095455378 12:42378185-42378207 ATCAAGAAAAAGTTTGTTCTGGG + Intronic
1095876129 12:47080745-47080767 AAGAAAAAAAGGTCTGCTCTGGG - Intronic
1097341953 12:58448811-58448833 ATTAAGAAGAGGTTTGAATTTGG + Intergenic
1097388599 12:58981328-58981350 ATTAAGATAAGTTCTGTACTTGG + Intergenic
1097826507 12:64179731-64179753 AGAAAGAAAACCTCTGATCTAGG - Intergenic
1098968457 12:76821277-76821299 AATAAGAAATGGGCTAATCTAGG - Intronic
1101986802 12:109453481-109453503 ATAAAGAAAAGGACTGAGCATGG - Intronic
1102122900 12:110456571-110456593 ATTAATAAAAAATTTGATCTTGG + Intronic
1104174383 12:126315764-126315786 ATTCAGAAAAGTTCTGATATGGG - Intergenic
1104489834 12:129184163-129184185 GTTAAGACAACATCTGATCTAGG + Intronic
1104708770 12:130969877-130969899 GTCTAGAAAAGGTCTCATCTTGG - Intronic
1106039428 13:26075548-26075570 ATTCAGGAAAAGCCTGATCTTGG + Intergenic
1106454219 13:29912397-29912419 AGTAAGACAAGGTCTGATATTGG + Intergenic
1108877475 13:55064014-55064036 ATTAAGAATAATTCTGACCTGGG - Intergenic
1109324165 13:60847718-60847740 AATAAGAAAAGTTCTTACCTAGG + Intergenic
1109344157 13:61094878-61094900 ATTCAAAAAAGCACTGATCTAGG - Intergenic
1113198121 13:107833273-107833295 ATTAAGGAAAGGTGTGGTATAGG - Intronic
1114857274 14:26464124-26464146 ATAAAGAAAAAGTGTGATCTAGG - Intronic
1117066589 14:52017806-52017828 TTTAAAAAAAGGTCAGGTCTTGG - Intronic
1120662390 14:87265972-87265994 GTTAAAATAAGGTGTGATCTAGG - Intergenic
1124932923 15:34140187-34140209 AGTAAGAACAGGTATTATCTTGG - Intergenic
1125036745 15:35133990-35134012 ATTTAGAAAATGGCTCATCTAGG - Intergenic
1125204850 15:37142227-37142249 ATTAGAAAAAGGGCTGATATTGG + Intergenic
1125635392 15:41183940-41183962 ATTTAGAAAAGGACTTATCCAGG + Exonic
1126418376 15:48443241-48443263 ATTAAGAAAAGGTTGGATATAGG - Intronic
1126914072 15:53445606-53445628 ATTAACATGTGGTCTGATCTAGG - Intergenic
1130145816 15:81273059-81273081 AAAAAGAGAAGGTCTGATTTAGG - Intronic
1130362128 15:83199285-83199307 ATTAATAACATGTTTGATCTTGG - Intronic
1132768066 16:1544946-1544968 ATTAAGAAATGCAGTGATCTGGG - Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134268612 16:12713742-12713764 ATTAGGAAAAAGTCTAATTTTGG - Intronic
1134481259 16:14621510-14621532 TTTAAGAAAACCTCTGAACTTGG + Intronic
1137484653 16:48881265-48881287 ATTAATTTCAGGTCTGATCTGGG + Intergenic
1139036111 16:62948521-62948543 ATTAAGAAAAGGAAAGATCATGG + Intergenic
1140263848 16:73403647-73403669 ACTAAGAAAGGGTCTGAACTGGG + Intergenic
1143116986 17:4586736-4586758 AGAAAGGAAAGGTCTGAGCTGGG + Intronic
1145689973 17:26730175-26730197 ATTAAAAAAAGGACTTGTCTCGG - Intergenic
1148661695 17:49339172-49339194 ACAAAGAAAAGGTCTGAGTTAGG + Intronic
1155129273 18:22914274-22914296 ATTTAGAAAACCTCTGCTCTTGG - Intronic
1157845279 18:50998551-50998573 ATTAATTAAAGCTCTAATCTAGG + Intronic
1157979029 18:52359054-52359076 AGTAAGAGAAGGGCTGATCTGGG + Intronic
1158912957 18:62086316-62086338 ATTAATAAAAAGCCTGAACTGGG + Intronic
1159813234 18:73042204-73042226 ATTAAGAAAATGTCTCATTGTGG - Intergenic
1159936483 18:74372197-74372219 ATTATGGGAAGATCTGATCTTGG - Intergenic
1162920916 19:13902336-13902358 CTTAAAAAAAAGTCTGAGCTGGG + Intronic
1164425130 19:28134497-28134519 TTTAGGAAAAGGTCTGAGTTTGG + Intergenic
929117618 2:38457417-38457439 CTTAGGCAAATGTCTGATCTGGG + Intergenic
931104125 2:59035428-59035450 ATAAAGAAAAAGTGTGAACTTGG - Intergenic
935216417 2:100978428-100978450 TTTTAGAAAAGGTCTGAATTGGG + Intronic
935496562 2:103789342-103789364 ATTCTGAAAAGTTCTGATATTGG - Intergenic
936656240 2:114490685-114490707 ATTAGAAAAAGGTCTGAATTTGG + Intronic
937836521 2:126476137-126476159 AATAAGAAAAAGTCAGATCTAGG + Intergenic
939466783 2:142566946-142566968 ATAAACAAAAGGTCAAATCTAGG + Intergenic
941085927 2:161118224-161118246 ATTAACAAAAGAACAGATCTGGG - Intergenic
941283338 2:163579944-163579966 AATAGGAAATGGTCTGATTTAGG + Intergenic
941670183 2:168284398-168284420 ATTAAGAAAAGTTTTTATCTGGG - Intergenic
941958479 2:171229372-171229394 AGTCAAAAAAGTTCTGATCTTGG - Intronic
943468958 2:188268245-188268267 ATTAAAAAAATGTTTGATGTGGG + Intergenic
944787569 2:203088809-203088831 ATCAAGAAAAGGTCTTGACTTGG + Intronic
945856724 2:215077832-215077854 ATAGATAAAAGGTCCGATCTCGG - Intronic
946392405 2:219424464-219424486 AGATAGAAAAGGTTTGATCTAGG - Intronic
1170843890 20:19946113-19946135 ATTAATAAAAGGTCTGCTTTAGG - Intronic
1174065980 20:47866523-47866545 ATCAAGTAAAGGTCTGGGCTGGG - Intergenic
1175668958 20:60885200-60885222 ATTAAGGAAGGGTCTGGACTTGG + Intergenic
1177852024 21:26359901-26359923 ATGAAGAAAAGGTGTGGTCAAGG + Intergenic
1178811776 21:35890263-35890285 AATAATAAAATGTCTGATATTGG + Intronic
1179126762 21:38598059-38598081 GTTAAGGAAAGCCCTGATCTTGG + Intronic
1182155965 22:28073248-28073270 CATGAGAAAAGGTCTGATTTTGG + Intronic
1183389760 22:37538876-37538898 ATGAAGAAGAGGGCTGATGTGGG + Intergenic
1184257377 22:43294914-43294936 ATTAAGATAATGCCTGAGCTGGG - Intronic
949711321 3:6874273-6874295 TTTAAGAAAAGGAAGGATCTCGG - Intronic
951945824 3:28134655-28134677 TTTAAAAAAAAATCTGATCTAGG + Intergenic
952126021 3:30301864-30301886 GTGAAGAAAAGGTCACATCTTGG + Intergenic
952541788 3:34374577-34374599 AATAAGAAATGGTTTGATCCTGG - Intergenic
953080490 3:39612150-39612172 ATTAAAAAAAGGGCTGAGTTTGG + Intergenic
953208690 3:40854972-40854994 TTTAAGCAAAGCTCTGATCGAGG - Intergenic
954146002 3:48634659-48634681 AGTCAGGAAAGTTCTGATCTAGG + Intronic
957069972 3:75560008-75560030 ATTCAGAAATGGTTTGATCAAGG + Intergenic
960305531 3:116055683-116055705 ATTACGAAAATGACTGATCCTGG - Intronic
960915107 3:122686954-122686976 ATAATGAAAAGGTCTGATAAGGG - Intronic
961284143 3:125786730-125786752 ATTCAGAAATGGTTTGATCAAGG - Intergenic
962449224 3:135498070-135498092 ATTAAGAGAAGCTATGATGTGGG + Intergenic
962509261 3:136082592-136082614 ATTAATAAAAGGCCAGATGTAGG + Intronic
962771861 3:138618793-138618815 ATTAAGGAAAGGGCTAAACTAGG + Intronic
963620543 3:147600010-147600032 CTTCAGAAATGGTCTAATCTAGG + Intergenic
965132106 3:164714359-164714381 ACTAAGGAAAGGTCTGTTCCAGG + Intergenic
965243907 3:166241351-166241373 AGTAAGAAAGTTTCTGATCTGGG - Intergenic
967147955 3:186621806-186621828 ATAAAGAAATGGTCATATCTTGG - Intergenic
967204468 3:187107015-187107037 GATAATAAAAGGACTGATCTTGG - Intergenic
969013563 4:4087466-4087488 ATTCAGAAATGGTTTGATCAAGG + Intergenic
969740248 4:9019654-9019676 ATTCAGAAATGGTTTGATCAAGG - Intergenic
969799578 4:9552454-9552476 ATTCAGAAATGGTTTGATCAAGG - Intergenic
971762166 4:30780862-30780884 ATTAAGAAAATCTCTGGTTTAGG + Intronic
972703733 4:41519503-41519525 AGGAAGAAAAGCTATGATCTTGG - Intronic
974870205 4:67633302-67633324 ATTAAGAAAAGGTCTGATCTTGG - Intronic
975400855 4:73938097-73938119 ATTAAGATAGTGTCTGATCCTGG - Intergenic
975545533 4:75556846-75556868 CTGAAGAAAAGGTTAGATCTAGG - Intronic
976945180 4:90756988-90757010 ATTAATTAAAGTTCTAATCTAGG - Intronic
978363230 4:107953179-107953201 ATTGAGAAGAAGTCTGTTCTTGG + Exonic
978481656 4:109199050-109199072 GTGAAGAAAAGATCTGAACTTGG - Intronic
978984113 4:114987842-114987864 ATTAAGTGAATGTCTGATCATGG + Intronic
979378357 4:119976904-119976926 ATAAAGAAAATGTTTGAACTTGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980145588 4:128979489-128979511 ATTAAGAAAATGGCAGATTTGGG - Intronic
980410856 4:132416404-132416426 ATGAAGAAAAGCTGTGATATGGG - Intergenic
981583541 4:146274502-146274524 ATTAATATAAGGTATAATCTAGG - Intronic
981882783 4:149635285-149635307 ACTGAGAATAGTTCTGATCTAGG - Intergenic
986749064 5:10769711-10769733 TTTTAGAAAAGGTCCGAGCTTGG + Intergenic
987213015 5:15703568-15703590 ATTTAGCAAAGCACTGATCTAGG + Intronic
989552020 5:42746339-42746361 AATAACAAAAGGTTTGATATTGG + Intergenic
990461842 5:56037920-56037942 ACTGAGCCAAGGTCTGATCTTGG - Intergenic
991599808 5:68341006-68341028 ATTAAGAAAAAGCCTGGGCTAGG - Intergenic
992719566 5:79547310-79547332 ATTCAGGAAAGGTTTTATCTAGG + Intergenic
992914175 5:81431879-81431901 ATTAAGAGAAGATATGAGCTGGG - Intronic
993620557 5:90162856-90162878 ATTCAGAAAAGTTCTGATCCAGG + Intergenic
994718502 5:103352597-103352619 ACTAAGAAATGATGTGATCTGGG + Intergenic
994920582 5:106038090-106038112 AATATGAAAACCTCTGATCTTGG + Intergenic
995647754 5:114331928-114331950 CTTAAGGGAAGGTCTGAGCTTGG - Intergenic
996524779 5:124466974-124466996 ATCAAGAAAGGATCTGAACTTGG - Intergenic
1005245987 6:23885725-23885747 ATTATGATAATGTCTTATCTCGG + Intergenic
1005513596 6:26533867-26533889 ATTAAAAATAAATCTGATCTTGG + Intergenic
1005839864 6:29736659-29736681 ATCAAGAAAGTGTCTGCTCTAGG - Intronic
1008515105 6:52311389-52311411 ATTCTCCAAAGGTCTGATCTTGG + Intergenic
1010566755 6:77424887-77424909 CTTAAGAAAAGGACTGAAGTAGG + Intergenic
1010898518 6:81396702-81396724 ATTAGAAAAAGGTGTTATCTAGG + Intergenic
1011260300 6:85463420-85463442 ATAAAAAAAAGATCTGATTTAGG + Intronic
1011760395 6:90558549-90558571 ATTTACAGAAGGTCTGGTCTAGG - Intronic
1012282286 6:97342589-97342611 ATTAAGGACAGGTCTGTTATTGG + Intergenic
1013374279 6:109498988-109499010 AGAAAGAAAATGTCTTATCTTGG - Intronic
1013950103 6:115769981-115770003 AGTAACAAAATGTCTGTTCTAGG - Intergenic
1014194941 6:118544580-118544602 ATTAAGAAAAGGACTCATATAGG - Intronic
1015053209 6:128867522-128867544 ACTAAAAAAAGCTATGATCTGGG - Intergenic
1019346719 7:534583-534605 ATTCAGGAGAGGTCTGATCAAGG + Intergenic
1020051559 7:5085376-5085398 GGAAAGAAAAGGTCTGAACTTGG + Intergenic
1020506574 7:8996741-8996763 AGAAAGAAAAGATCTGATGTTGG - Intergenic
1020591425 7:10143127-10143149 AATAAGAATAGTTCTGATTTTGG + Intergenic
1020747464 7:12095169-12095191 TGTAAGAACAAGTCTGATCTAGG - Intergenic
1021272261 7:18604692-18604714 ATTTAAAAAAGGTCTTATCCGGG - Intronic
1023643926 7:42289538-42289560 AGTAGGAAAAGCTATGATCTTGG - Intergenic
1024781548 7:52856427-52856449 ACTAAGTCAAGGCCTGATCTCGG - Intergenic
1024881983 7:54096941-54096963 AATAAGAGAAGGACTGAGCTTGG + Intergenic
1024978835 7:55139424-55139446 ATTAAAACAAGGTATGATCTTGG - Intronic
1027135629 7:75621981-75622003 GTTCAGAAAAGGTCTAAGCTAGG + Intronic
1028612452 7:92727015-92727037 ATTAGAAAAAGATCTGATATTGG - Intronic
1029072214 7:97909084-97909106 ATTCAGAAATGGTTTGATCAAGG + Intergenic
1029820286 7:103140351-103140373 AGTAAGAGAAGGCCTGATCTTGG + Intronic
1031112600 7:117630340-117630362 ATTAAGAGAAGGTTTTATATAGG + Intronic
1032187751 7:129741834-129741856 ATTAAGCAAATGTCAGAGCTGGG - Intronic
1033930467 7:146513858-146513880 TTTAAGAAAGGGTCTGGTCTTGG + Intronic
1035141914 7:156771221-156771243 ATTCAGAACAGCTCTGATTTTGG - Intronic
1036082038 8:5567837-5567859 AATAAGAAAGTGTCTGTTCTAGG + Intergenic
1036245452 8:7112207-7112229 ATTCAGAAATGGTTTGATCAAGG - Intergenic
1036255314 8:7201584-7201606 ATTCAGAAATGGTTTGATCAAGG + Intergenic
1036362175 8:8085912-8085934 ATTCAGAAATGGTTTGATCAAGG - Intergenic
1036888784 8:12581117-12581139 ATTCAGAAATGGTTTGATCAAGG + Intergenic
1036896378 8:12639255-12639277 ATTCAGAAATGGTTTGATCAAGG + Intergenic
1039253877 8:35696974-35696996 GTTAACAAAAGATCTGAACTGGG - Intronic
1039365717 8:36925983-36926005 TGTAGGAAAAGGTATGATCTGGG - Intronic
1039393258 8:37200154-37200176 ATTGAGACAAGCTCTGGTCTAGG - Intergenic
1042462437 8:69085865-69085887 ATGAAGAAAAGGTTAGATCTAGG - Intergenic
1044056704 8:87579553-87579575 AATAAGAAAAGAACTGGTCTTGG + Intronic
1044937855 8:97310305-97310327 ATTTAGAAAAGGTATTATGTTGG - Intergenic
1050544913 9:6701531-6701553 GTTGAGAAAAGGTCAGATTTGGG + Intergenic
1050580391 9:7048691-7048713 ATTAATAAAAGGTATGAACTGGG - Intronic
1051078326 9:13266686-13266708 CTTAATAAAAGGTCTGAGTTAGG - Intronic
1052112047 9:24598010-24598032 ATTAAAAAATGGTCAGATTTTGG + Intergenic
1053195648 9:36116420-36116442 CTTAAGAAAAGGCCTCAGCTGGG - Intronic
1055265252 9:74487817-74487839 ACTAAGAAATGATCTGATTTTGG + Intergenic
1057452606 9:95178254-95178276 ATTCAGATAAGGTCTGTTCCAGG - Intronic
1057588741 9:96353021-96353043 ATAAAAAAAAGTTCTGACCTTGG + Intronic
1058101350 9:100920750-100920772 ATTAAGAAGAGATCTAATGTGGG - Intergenic
1058189023 9:101890608-101890630 AATAAGAAAAGGTCAAATGTTGG + Intergenic
1059425642 9:114219376-114219398 AATCAGAGAAGGTCTGAGCTGGG + Intronic
1061115608 9:128609147-128609169 ATTGAGAAAAGGTCAAAGCTAGG + Exonic
1061644331 9:131987997-131988019 ATTAAGACAAGGACTGGTTTAGG + Intronic
1187194290 X:17067781-17067803 ATAAAGAACAGGTTTGTTCTTGG + Intronic
1190407255 X:50100535-50100557 ATTAAGAGAATGTCTGATAAAGG - Intergenic
1190501492 X:51083056-51083078 ATCAAGAAAATGTCTGATTTTGG + Intergenic
1191736124 X:64389773-64389795 ATTAAGATAAGGTATGATGAGGG - Intronic
1193328626 X:80211295-80211317 ATTAAGAAAGGTTGTGATATGGG - Intergenic
1194266754 X:91763191-91763213 TTTAAGAAAATCACTGATCTAGG - Intergenic
1194514469 X:94834464-94834486 ATAAAGAAAAGATCTGTTCCAGG + Intergenic
1194575547 X:95609960-95609982 AATAACAAAAGGTCTCATTTAGG - Intergenic
1194946239 X:100071349-100071371 ATCAAGAAAAGCTTTGATGTAGG - Intergenic
1197473577 X:126892363-126892385 ATTAAGATATGGTAGGATCTGGG + Intergenic
1198208234 X:134489914-134489936 CTTAACAAGAGGTCTAATCTTGG - Intronic
1198826546 X:140704266-140704288 ATTAAGAGAAGATGTCATCTGGG - Intergenic
1200583955 Y:4984103-4984125 CTTAAGAAAATCACTGATCTAGG - Intergenic