ID: 974873046

View in Genome Browser
Species Human (GRCh38)
Location 4:67667244-67667266
Sequence CAAAATAATTAGATATAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974873046 Original CRISPR CAAAATAATTAGATATAGTC AGG Intronic
901403855 1:9032876-9032898 AAAAATAAGTAGACATAGGCCGG - Intergenic
901707263 1:11083578-11083600 AAAAAAAATTAGATATATGCAGG + Intronic
902242453 1:15098169-15098191 CACAAAATTTAGATATTGTCTGG - Intronic
902432441 1:16373762-16373784 CAAAAAAATCAAAAATAGTCAGG - Intronic
902596377 1:17512409-17512431 CAAAAAAATTAAATGTAGGCTGG - Intergenic
903890204 1:26564692-26564714 CTAAAAAATTAGACATAATCAGG - Intronic
905301773 1:36990544-36990566 CAAATTAATGAGAGCTAGTCTGG - Intronic
907032084 1:51182348-51182370 CAAAATAATGAAATATGGCCAGG + Intergenic
907129093 1:52079220-52079242 TAAAATAATTTGAATTAGTCGGG + Intronic
908231030 1:62105181-62105203 CAAAATCCTTAGATATTTTCTGG - Intronic
908838353 1:68251638-68251660 AAAAATAATAAAATATAGGCTGG - Intergenic
910910419 1:92228286-92228308 CAAATTAATCATTTATAGTCTGG + Intronic
911769178 1:101717499-101717521 CAAAATAATTAGAATAAGTAGGG - Intergenic
911977027 1:104510882-104510904 CAAAATATTTAGGTATATTCTGG - Intergenic
912114225 1:106384378-106384400 GATAATAATTAGTTATAGTGAGG - Intergenic
914682322 1:149947379-149947401 CAAAGCAATTTGATATAGTTGGG + Intronic
916837238 1:168559073-168559095 GAAAATAATTAAATATTTTCAGG - Intergenic
916953630 1:169808893-169808915 TAAAATTATTACATATAGGCTGG - Intronic
917636484 1:176942048-176942070 AAAAACAATTAAATATATTCTGG - Intronic
917702233 1:177593105-177593127 CAAAATAATTCGTTATAATTGGG + Intergenic
918945505 1:191059429-191059451 CAAAATAATAAGATCTATTTAGG - Intergenic
920019412 1:202943162-202943184 TAAAATAATTAAATATTGTCCGG - Intronic
921288620 1:213632960-213632982 CAAATTAATTAAATAAAGTGAGG + Intergenic
922911596 1:229222511-229222533 TAAAAAAAATAGATATAGGCTGG - Intergenic
924596629 1:245450803-245450825 AAAAATAAAGAGATATAGTATGG + Intronic
1063452455 10:6159742-6159764 CAAAATCATTACATATGGTAAGG + Intronic
1063524173 10:6768733-6768755 AAAAATAATTATATATTGGCTGG + Intergenic
1063613415 10:7582236-7582258 CAAAATAAATAAATAAAGTTGGG + Intronic
1064789777 10:18944348-18944370 CAAAATAATTAAATTTAGGTGGG + Intergenic
1065728417 10:28689112-28689134 TAAAATAAATAAATATAGGCCGG - Intergenic
1066170920 10:32844367-32844389 AAAAATAATTAGATATTTTGTGG - Intronic
1066592793 10:37013808-37013830 CAAAATCATTTGATATATTGAGG + Intergenic
1067675419 10:48371220-48371242 AAAAATTATTAGCTATAGTCTGG + Intronic
1069342017 10:67422153-67422175 AAAAATAAATAGACATAATCTGG + Intronic
1071246019 10:83764673-83764695 CAAAATAAATAAATAAAGCCAGG + Intergenic
1071763590 10:88636576-88636598 CAAAATAACTAGATAGCATCAGG - Intergenic
1072974980 10:100049576-100049598 CAAAATAAATAAACAGAGTCCGG + Intronic
1073932568 10:108592625-108592647 TAAAAAAGTTAGAAATAGTCCGG - Intergenic
1074028574 10:109662694-109662716 TTAAATAATTAGAGATAGTCTGG + Intergenic
1076227008 10:128785723-128785745 TAAAGTAATTAAATATAGTATGG - Intergenic
1077560795 11:3259064-3259086 TAAAATAAATAGTTATAGACAGG - Intergenic
1077566691 11:3304892-3304914 TAAAATAAATAGTTATAGACAGG - Intergenic
1078471797 11:11593564-11593586 AAAAAAAATTAGATGTGGTCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078831544 11:14981832-14981854 CAAACTAAATTGATATAGTTTGG - Intronic
1079195547 11:18323227-18323249 CAAAATAATTACATATATCCAGG - Intronic
1079475005 11:20820894-20820916 CAAAATAAATATATATTGTTAGG - Intronic
1079734420 11:23977906-23977928 AAAAATAAATAAATTTAGTCAGG - Intergenic
1080489134 11:32744048-32744070 CAAAATAATTAGAGCTATTTAGG - Intronic
1080529692 11:33162566-33162588 GAAAATAAATAAATAAAGTCAGG + Intergenic
1082793096 11:57360857-57360879 CCAAATTATTAGCTATAGTCTGG + Intronic
1083914474 11:65731449-65731471 CAAAAGAATTAAATATTGGCCGG - Intergenic
1084371170 11:68744990-68745012 CAAAATAATTATCTACAGTCAGG - Exonic
1085307343 11:75494969-75494991 CAAAATATATATATATAGGCTGG + Intronic
1085667214 11:78425085-78425107 CAACATAATTTGATGTAATCAGG + Intergenic
1085737933 11:79055536-79055558 TAAAATAATAATAAATAGTCTGG - Intronic
1085783891 11:79434715-79434737 CAAAATAAATAGCCATATTCTGG + Intronic
1085826415 11:79852525-79852547 CACACTAATTTGATATATTCTGG - Intergenic
1085843628 11:80041654-80041676 CAAAATAATTTTATGTAGTTTGG + Intergenic
1087222687 11:95563487-95563509 CCAAATGATTAGATCTAGTAAGG - Intergenic
1087361138 11:97160979-97161001 TAAAATAAGGAGATATATTCAGG + Intergenic
1087390875 11:97532194-97532216 ATAAATAATTAGATATAATTTGG - Intergenic
1087672160 11:101120398-101120420 CAAAATACTTCAATATATTCTGG + Intronic
1087713021 11:101576267-101576289 CAAAATATTTATATATATTTGGG - Intronic
1088075731 11:105846134-105846156 CAAAATACTTAAATATTGTTAGG - Intronic
1088525995 11:110755798-110755820 CAAAATATTCAGATACAATCTGG - Intergenic
1088779986 11:113124629-113124651 CAAAATAAATAGTTATCATCAGG - Intronic
1093642996 12:21550005-21550027 CAAAATAAATAAAGATAGTAAGG - Intronic
1094355283 12:29571258-29571280 CATAATAACTAAATATAGCCTGG - Intronic
1096731367 12:53615708-53615730 CAAAATAATTAAAGATTGGCTGG + Intronic
1098635388 12:72778211-72778233 CCAACTCATTAAATATAGTCAGG - Intergenic
1099405817 12:82260787-82260809 CAAAGTAATTAAACATAGTATGG - Intronic
1100101919 12:91119084-91119106 CATAATAATTACACATAGCCTGG + Intergenic
1101611387 12:106295550-106295572 CAAAATAATTGTATATAATGAGG - Intronic
1102102879 12:110294361-110294383 CAAAAAAATTATATTTGGTCAGG + Intronic
1102333922 12:112060692-112060714 CTAAAGAATTAGATGAAGTCAGG - Intronic
1102672369 12:114631001-114631023 CAGGATAATTAGATCTAGCCTGG - Intergenic
1103743995 12:123109935-123109957 CACATTAATCAGATAAAGTCAGG + Intronic
1105523951 13:21157227-21157249 CTAAAGAATCAGATACAGTCAGG + Intronic
1105791574 13:23805445-23805467 CAAAGGAATTAGATAGAGTCTGG + Intronic
1105865616 13:24456616-24456638 CAAAATAATGAAATGTAGGCCGG + Intronic
1105965274 13:25377955-25377977 CAAAAAAATTATAAATAGCCAGG + Intronic
1106149692 13:27087224-27087246 CCAAATAAGTAAATATAGTGGGG + Intronic
1107616472 13:42173130-42173152 CAAAAAAATTAAAAATAGCCTGG - Intronic
1109463946 13:62702411-62702433 CAAAATAGATAAATATAGTTAGG + Intergenic
1109885468 13:68536965-68536987 CAAAATAAATACATTTAGTTTGG + Intergenic
1110937540 13:81310760-81310782 CAAAATATTGAAATACAGTCAGG + Intergenic
1112151474 13:96769284-96769306 AAAAATAAATAAATAAAGTCAGG - Intronic
1113228992 13:108191820-108191842 GAAAATAATTAAATATATGCAGG + Intergenic
1114445116 14:22782397-22782419 AAAAATAATAAAATATAGGCCGG - Intronic
1114992915 14:28311030-28311052 AAAAGTAATTTGATAGAGTCAGG - Intergenic
1115671262 14:35614356-35614378 CAATATAATGAGATATTTTCTGG + Intronic
1116143909 14:41038405-41038427 CAAAAAAATTAGGTATAGTGTGG + Intergenic
1117295711 14:54377462-54377484 CAAAATATTTAGGTACAGTGAGG - Intergenic
1118792593 14:69108801-69108823 CACAATGATTAGCTTTAGTCGGG - Intronic
1119008062 14:70952504-70952526 AAAAATAAATAAATATATTCAGG - Intronic
1119652484 14:76393423-76393445 AAAAATAGTTACATATGGTCAGG + Intronic
1119772236 14:77227435-77227457 CAAAATGATGAGATGTAGTCAGG + Intronic
1120396086 14:83969051-83969073 CAATATTATGAGATATTGTCAGG - Intergenic
1120882586 14:89425659-89425681 AAAAATAATCAGCTATAGGCTGG - Intronic
1202905515 14_GL000194v1_random:69247-69269 AATAATAATTTGATATGGTCAGG + Intergenic
1124809122 15:32916696-32916718 CAAATGGACTAGATATAGTCTGG + Intronic
1125105500 15:35966460-35966482 GAAAATAAGTAGATATTTTCTGG - Intergenic
1125246710 15:37648868-37648890 CAAAATAAAAAAGTATAGTCGGG + Intergenic
1126432632 15:48602311-48602333 CAAAATAAGTAAAAATAGGCTGG - Intronic
1128023116 15:64410338-64410360 TAAAACAATGAGATATAGTATGG + Intronic
1130726965 15:86449150-86449172 GAAAATAAATAGAGATAGGCTGG + Intronic
1134855164 16:17512498-17512520 CAAAATAAATAAATAAAGGCAGG - Intergenic
1135713764 16:24742623-24742645 TAAAATAATTAGAAAATGTCTGG + Intronic
1138674763 16:58643130-58643152 TAAAAAAATTAAATATAGGCAGG - Intergenic
1139397985 16:66655815-66655837 CAAAATAAATAATTATAGTTTGG + Intronic
1139814534 16:69657787-69657809 AAAAATAAATACATATAGGCCGG + Intronic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1141051968 16:80775082-80775104 CAACATAATTACATATGTTCAGG + Intronic
1142821080 17:2467720-2467742 TAAAATAATTGAATATAGGCTGG - Intronic
1143455157 17:7062710-7062732 CAAAAAAATAAAATATACTCGGG + Intergenic
1146178401 17:30681462-30681484 TAAAATAATTAAACATAGGCTGG + Intergenic
1150049123 17:61941543-61941565 CAAAACAGTTAGATTTAGCCAGG + Intergenic
1150504652 17:65685957-65685979 AAAAATAATTAGAATTAGGCTGG - Intronic
1150989222 17:70236302-70236324 CAGAATAACTAAACATAGTCTGG - Intergenic
1151955848 17:77379796-77379818 CAAAATAAAAAGAAAAAGTCGGG - Intronic
1153189098 18:2518250-2518272 CAAAATGATTATATATAGATGGG - Intergenic
1155025643 18:21938037-21938059 AAAAAAAATTAGACATAGGCTGG + Intergenic
1156255879 18:35395809-35395831 CAAAACAATTATATATACTATGG - Intergenic
1156533980 18:37845423-37845445 AAAAAAAATTAAATATATTCTGG - Intergenic
1156798917 18:41084335-41084357 GAAAATAATAAAATATAGCCAGG + Intergenic
1157025905 18:43842463-43842485 CAAAATAATTTGAAATATTGAGG - Intergenic
1157241745 18:46016363-46016385 CAAAATAAATAAATAAAGTATGG + Intronic
1158167957 18:54562832-54562854 CAAAGTAATTAAATCCAGTCAGG - Intergenic
1158325340 18:56307833-56307855 CAAAATAATTAATTTGAGTCTGG + Intergenic
1158683603 18:59592242-59592264 CAAAATAAATAGTTATTTTCAGG + Intronic
1158991945 18:62877909-62877931 CAAACTAATTTAATATAGCCTGG - Intronic
1159330107 18:66981995-66982017 CAAAATCATTTGATATTGTCAGG + Intergenic
1162813173 19:13176988-13177010 CAAAAAAATTAGCCATAGGCCGG + Intergenic
1162980194 19:14233998-14234020 TAAAATAATTAAACATAGGCCGG - Intergenic
1163825857 19:19524522-19524544 GAAAATAATGAGATATGGCCGGG + Intronic
1163992416 19:21010824-21010846 CAAAAAAATTAAAAATAGGCTGG + Intergenic
1164000506 19:21093927-21093949 TAAAATAATAAGGTATGGTCAGG - Intronic
1164657381 19:29932947-29932969 AAAAATAAATCGATGTAGTCCGG - Intronic
1165474198 19:36020304-36020326 AAAAATAAATAAATTTAGTCCGG + Intronic
1165988802 19:39793821-39793843 CAAAATAATCAGAGATATTGAGG - Intergenic
1167380487 19:49135358-49135380 AAAAATAAATAAATAAAGTCAGG - Intronic
925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG + Intronic
925679662 2:6406429-6406451 CTAAATAATTAGATATACTAAGG - Intergenic
925936599 2:8768859-8768881 TAAAATAATTATATATAATAAGG - Intronic
927482178 2:23462745-23462767 CAAAAAAATTTAATATATTCAGG - Intronic
927531355 2:23806017-23806039 TTAAATTAATAGATATAGTCTGG - Intronic
927773153 2:25881063-25881085 AAAAATAATTTGATATGGTAGGG - Intergenic
928156607 2:28882759-28882781 CAAAAAAATTAAAAATAGGCCGG - Intergenic
929129120 2:38548771-38548793 ACAAATAATTAGAAATAGGCTGG - Intergenic
930168774 2:48230326-48230348 CTAAATATTTATATAAAGTCTGG + Intergenic
930342054 2:50129288-50129310 AATAATAATTGGATATAGTTCGG + Intronic
930890503 2:56380719-56380741 CAAAATATTAAAATTTAGTCAGG - Intronic
931420435 2:62122085-62122107 CAAAATAAATAAATATGGCCAGG - Intronic
933012595 2:77086789-77086811 TAAAATTATTACATATAGGCCGG - Intronic
936625844 2:114148660-114148682 TTAAATAATTAGATATGGGCCGG + Intergenic
937563340 2:123252780-123252802 AAAAATAATAACATATATTCAGG - Intergenic
937596455 2:123680891-123680913 CATAATAAATAAATATACTCTGG + Intergenic
938060595 2:128251535-128251557 AAAAAAAATTACCTATAGTCTGG - Intronic
938465679 2:131523302-131523324 GGAAATAATTAGATATATTTCGG - Intergenic
939694612 2:145309197-145309219 AAAAAGAATTAGATATTGTTTGG + Intergenic
941018174 2:160380485-160380507 CAAAATGATTTGATATCGTACGG - Intronic
941184677 2:162306968-162306990 CAAAGTATTTAAATATATTCAGG - Intronic
941863733 2:170312093-170312115 CAAAGAAATAAGACATAGTCAGG - Intronic
942559260 2:177202950-177202972 CAAAAAAATAAAAAATAGTCGGG + Intergenic
943483324 2:188449429-188449451 CAAAATAAATAGATGTATTGGGG - Intronic
945529910 2:210939716-210939738 TAAAATAATTAGAAATACTGAGG + Intergenic
946205545 2:218104694-218104716 CAAAATAATAAGAGCTAGTTAGG - Intergenic
946485222 2:220094815-220094837 CAAAAATATTAAATATAGGCAGG - Intergenic
946694443 2:222339969-222339991 CAAATTTAGTAGATATAGTTTGG + Intergenic
1169515169 20:6309185-6309207 CAACATCATTAGAAATATTCAGG - Intergenic
1169742578 20:8911157-8911179 CAAAATAATTGGATAAAGGCTGG + Intronic
1170028302 20:11915364-11915386 CAAAATAATTTAATTTAGTTTGG - Intronic
1171004481 20:21450861-21450883 CAAAATAATTAAGTATAGTAAGG + Intergenic
1172051063 20:32118576-32118598 CAAAATAAATACATTTAGGCTGG - Intronic
1173633584 20:44535006-44535028 AAAAATACTTAGATATAATAAGG + Intronic
1174688706 20:52481113-52481135 TAATATAATAAAATATAGTCTGG - Intergenic
1175556600 20:59864272-59864294 AATAATAATTAGATAAAGTATGG + Exonic
1177336104 21:19729925-19729947 AAAGATAATTAGATATAATCGGG - Intergenic
1183289638 22:36992050-36992072 CAAAATAAGTATATTTAGGCCGG + Intronic
949237577 3:1828728-1828750 GGAAATAATTTAATATAGTCTGG + Intergenic
949759573 3:7454650-7454672 GAAAATAATTATATATATTGCGG + Intronic
949913950 3:8942090-8942112 CAAAATATACTGATATAGTCTGG + Intronic
950240300 3:11363702-11363724 CAAAGTCATTAAACATAGTCTGG - Intronic
950325279 3:12102660-12102682 CAGAATAATGTGATATAATCAGG + Intronic
950924168 3:16723583-16723605 AAAAATAATTAGGTATAAGCAGG + Intergenic
951626213 3:24666591-24666613 CAAAATCATTAAAGATAGGCAGG - Intergenic
954236994 3:49264557-49264579 AACAAAAATTAAATATAGTCCGG + Intergenic
955908855 3:63838893-63838915 AAAAATAAATAAATATAGTTAGG + Intronic
956223425 3:66928687-66928709 AAAAATTATTAGATCTAGTGAGG + Intergenic
957774624 3:84740841-84740863 TAAAATAATTGTATAGAGTCTGG - Intergenic
958511434 3:95054654-95054676 CAAAATAAATAATTATAGTGTGG + Intergenic
958585293 3:96079696-96079718 TAAAATTATTAGAAATAGTAAGG + Intergenic
958770054 3:98415167-98415189 CCAAATTAAAAGATATAGTCTGG + Intergenic
958830089 3:99076607-99076629 CAAAATAAGTAGATATGTTCTGG + Intergenic
959121242 3:102235025-102235047 CAAAATAATTACATAGATTGTGG - Intronic
960278800 3:115757654-115757676 CCAAACAATTAGAAATAATCTGG - Intergenic
960514146 3:118584344-118584366 CACATTAATTAGACAGAGTCAGG - Intergenic
960551880 3:118985017-118985039 GAAAATTATTAGAAAAAGTCCGG - Intronic
960723421 3:120646717-120646739 CTAAATATTTACATATACTCTGG - Intronic
960803646 3:121562552-121562574 AAAAATAATTAAATAGAGACAGG + Intergenic
961680920 3:128599519-128599541 CAGAATAAATAGATACAGGCCGG + Intergenic
961802134 3:129459516-129459538 AAAAAAAAATAGATGTAGTCAGG - Intronic
961990748 3:131187959-131187981 CAATTTAATTAGAGATGGTCAGG + Intronic
962039725 3:131693857-131693879 CAAAAGACTTAGATTTTGTCAGG + Intronic
964005294 3:151819722-151819744 TAAAATAATTGGATATAGATAGG + Intronic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
964891598 3:161542916-161542938 AAAAACAATAAGATATATTCTGG + Intergenic
965988430 3:174785735-174785757 CAAAATAAATAAATATAGCAGGG - Intronic
966203668 3:177383711-177383733 TAAAATAATTAAAGATAGGCCGG + Intergenic
967049804 3:185772372-185772394 GAAAATATTTAGATATCGTGTGG - Intronic
967317994 3:188168019-188168041 GACAATATTTAGAAATAGTCTGG + Intronic
969035096 4:4247058-4247080 TAAAATATTTAGTTATAGGCTGG - Intronic
970656190 4:18232979-18233001 TAAAATAATTATAAATAGTATGG + Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
971782837 4:31059486-31059508 GAAAATATTTACATATACTCTGG - Intronic
972911814 4:43825898-43825920 TAAAATATATTGATATAGTCTGG - Intergenic
972981230 4:44704539-44704561 CAAAATAATTATTTCTAGTTTGG - Intronic
973547810 4:51999504-51999526 AAAAATACTTAGCTTTAGTCTGG + Intronic
974551538 4:63381035-63381057 CCAAAAAAGTAGATAGAGTCAGG - Intergenic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
975275586 4:72496182-72496204 CAAAATAAGCAGATAAAATCTGG + Intronic
975886199 4:78968524-78968546 CAAAATAAATAGATATATTAAGG + Intergenic
976988824 4:91337987-91338009 CAAAGGCATTAGCTATAGTCAGG - Intronic
978091279 4:104719107-104719129 TAAAATAATTGGATATAGGTAGG + Intergenic
978108072 4:104929222-104929244 TAACATAATTACATATAGTCAGG + Intergenic
978774797 4:112494964-112494986 CAAGATAATTATATAAAGTTTGG - Intergenic
979416749 4:120450608-120450630 TACAATAACTAGATATATTCAGG + Intergenic
979902725 4:126243508-126243530 AAAAATAAATAAATAAAGTCAGG - Intergenic
980803058 4:137777678-137777700 AAAAATAATTAGATAAACTGAGG - Intergenic
981319686 4:143377072-143377094 AATAATATTTAGATTTAGTCTGG + Intronic
981766370 4:148254667-148254689 GTAAATAATTAGAAAGAGTCAGG + Intronic
983733891 4:171033490-171033512 AAAAATAATATGATATAGTTTGG + Intergenic
983892434 4:173044252-173044274 CAAAATAATGCAATATATTCAGG - Intergenic
984226807 4:177045100-177045122 CAAAGTAATTTGATTTATTCAGG + Intergenic
984990463 4:185375737-185375759 AAAAATAATTAAATATCTTCTGG - Intronic
985728826 5:1532626-1532648 CAAAAAAATTATATATTGTGGGG - Intergenic
985983733 5:3494262-3494284 CCAAATATTTAGATATTTTCTGG + Intergenic
986223828 5:5794641-5794663 TAAAATAATTAGAGATATCCTGG + Intergenic
987522603 5:19005943-19005965 CAAATTAATTAAATATGGACTGG - Intergenic
988210292 5:28195256-28195278 TCAAATAATTTGATGTAGTCTGG - Intergenic
988792935 5:34625207-34625229 CAAAAACATTAGATATAGTTTGG + Intergenic
990032370 5:51277598-51277620 TAAAATAATGGGATATAGGCCGG + Intergenic
990319837 5:54619041-54619063 AAAAATAATTAGGCATAGACAGG + Intergenic
992014602 5:72563154-72563176 TAAAATAATTAGAAAGAGCCTGG + Intergenic
992723622 5:79584536-79584558 TAAAAAAATTAGAAATAGGCTGG - Intergenic
993069574 5:83143249-83143271 GAAAATACTTAGGTATAGTAAGG + Intronic
993563122 5:89437116-89437138 CAAAATAATTAGATATATTATGG - Intergenic
993773282 5:91958955-91958977 CAAAATATTTAAATATACTTGGG + Intergenic
994679220 5:102865053-102865075 CAACATAATTAGAAAGAGTAGGG - Intronic
994879510 5:105470313-105470335 GAAAATAATTAGAGATACTCAGG + Intergenic
994881244 5:105499323-105499345 CAAAATATTTGGATATATTTTGG - Intergenic
995021781 5:107374755-107374777 GAAAATCATTAGAAATAATCTGG - Intergenic
996494257 5:124135485-124135507 ATAAATAATTATATATAATCTGG + Intergenic
996537054 5:124588812-124588834 GAAAATAACTAGATAAAGTAAGG - Intergenic
997327600 5:133034912-133034934 CAAAATAAGCAAATATAGACAGG + Intergenic
1000988435 5:167886591-167886613 CAAAATAATTAGCTATAAAAAGG + Intronic
1001349788 5:170949210-170949232 CTAATTAATTAGATAAACTCTGG - Intronic
1001775227 5:174323915-174323937 GAAAAGAAGGAGATATAGTCTGG - Intergenic
1001883562 5:175267602-175267624 CAAAATAATTATAAATAGGGAGG - Intergenic
1002653469 5:180722807-180722829 CATAATAATTGTATATATTCAGG + Intergenic
1002653483 5:180722907-180722929 CATAATAATTGTATATATTCAGG + Intergenic
1003297259 6:4842371-4842393 CACAATAATAATATATAGTGGGG - Intronic
1005130997 6:22507897-22507919 AAAATTAAATAAATATAGTCAGG + Intergenic
1005690037 6:28295870-28295892 CAAAATAATTATCTGTAGTTTGG + Intronic
1008193117 6:48484442-48484464 CAAATTAATTAGATAAATTCTGG + Intergenic
1008299887 6:49823391-49823413 CAAAATAATTAAACATACTTGGG - Intergenic
1008720761 6:54348413-54348435 CAATACAATGAGATTTAGTCAGG - Intronic
1009560053 6:65228459-65228481 CTAAATAAATAGATATATTGTGG + Intronic
1009909722 6:69911475-69911497 CAAATTACTTAGATATAGCCAGG - Intronic
1009914980 6:69983152-69983174 CTAAATAAATAGATATATTATGG - Intronic
1010198061 6:73259455-73259477 TAAAATAATTGGATTTAGCCAGG - Intronic
1010454014 6:76034445-76034467 CAAAATAATATGGTACAGTCAGG - Intronic
1010483418 6:76381439-76381461 TAAAATAATTAGAAAGAATCAGG - Intergenic
1010956339 6:82094873-82094895 CAATATAATTTGATATAATTTGG + Intergenic
1012456132 6:99407485-99407507 CAAAATAACTAGATTTTGGCAGG - Intronic
1012936168 6:105369954-105369976 TAAAACAATCAGATATGGTCGGG + Intronic
1014020379 6:116580544-116580566 GAAATTAATGAAATATAGTCTGG + Intronic
1014172587 6:118295264-118295286 CAGAATAAATAAATATTGTCTGG - Intronic
1014797183 6:125739311-125739333 CTAAATTATTAGAAATAGTCAGG - Intergenic
1015735621 6:136396794-136396816 CAAAATAATTACACATAATATGG + Intronic
1017109602 6:150919856-150919878 CTAAACAATTTGATATAGTTTGG - Intronic
1017790842 6:157797806-157797828 CAAAATAAGTAACTATAGTAAGG + Intronic
1018292949 6:162311691-162311713 CATAATAATTATTTATAGCCTGG - Intronic
1018327694 6:162691183-162691205 CTATATATTTAGATATAGTAGGG - Intronic
1020380524 7:7540039-7540061 TAAAATAATTGCATTTAGTCAGG - Intergenic
1020393787 7:7689712-7689734 CAAAACAATTGGAAATAGTCTGG + Intronic
1021836451 7:24680953-24680975 AAAATTAATTAGATGTAGTTAGG + Intronic
1021956731 7:25832678-25832700 CAAACAAATACGATATAGTCTGG - Intergenic
1021996403 7:26182325-26182347 CAAAATAATTCCATGTAGGCCGG + Intronic
1022742346 7:33134889-33134911 CAAAATAAATAAATAAAGCCAGG - Intronic
1024099191 7:46011639-46011661 CAAAATACTGAGAAATAGTCAGG + Intergenic
1024703512 7:51930311-51930333 CAAAATAAATAAATAAAGGCAGG + Intergenic
1026369047 7:69680382-69680404 CACAATAAGTAGATAAAGACAGG - Intronic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1032399747 7:131616425-131616447 CAAAACAATTAAATATTGGCTGG - Intergenic
1033505858 7:141999018-141999040 CAAAATAAATAAATATACACTGG - Intronic
1034888807 7:154820962-154820984 CCAACTAATTAAATATAGACTGG + Intronic
1037081777 8:14796631-14796653 CAAAATAAGTAGAGAGTGTCAGG - Intronic
1041128895 8:54675372-54675394 TAAAATACTCAGAGATAGTCAGG + Intergenic
1042111301 8:65383945-65383967 CAAAATAATAAGAGATACTTAGG + Intergenic
1043419655 8:80085606-80085628 CAAAAAAATTAGGGACAGTCAGG + Intronic
1043601226 8:81940723-81940745 TAAAATTTTTAGATTTAGTCTGG + Intergenic
1044425068 8:92041003-92041025 TAAGATAATTAGAAATAGCCTGG - Intronic
1044446311 8:92280882-92280904 CAAAATAATTAGAGAAAGAAAGG + Intergenic
1046170228 8:110496678-110496700 CAAAATAATATGATATGGTTTGG + Intergenic
1046173867 8:110549010-110549032 CAAAATAATTACCTAGATTCTGG - Intergenic
1046773488 8:118139517-118139539 AAAAATATATAGATATAGTCAGG - Intergenic
1046942556 8:119944948-119944970 CAAAATAATTCATTATAGGCTGG - Intronic
1047964740 8:130038280-130038302 CAAAATAAATGCATATAGGCTGG - Intergenic
1048751590 8:137682890-137682912 CAGAATATTTAGCTATAGCCAGG + Intergenic
1050275685 9:3996392-3996414 CAAAATAGATAGATAGATTCTGG + Intronic
1051082846 9:13313043-13313065 AAAAATAATTACATAGAGGCAGG - Intergenic
1052490247 9:29157958-29157980 CAAAGTATATAGATATAGCCTGG - Intergenic
1052721828 9:32180966-32180988 AAAAATAGCTATATATAGTCAGG - Intergenic
1053650249 9:40161378-40161400 CAAAACAATTAGAAATAGCATGG + Intergenic
1053755489 9:41302548-41302570 CAAAACAATTAGAAATAGCATGG - Intergenic
1054330754 9:63753151-63753173 CAAAACAATTAGAAATAGCATGG + Intergenic
1054534332 9:66214825-66214847 CAAAACAATTAGAAATAGCATGG - Intergenic
1054830912 9:69623572-69623594 AAGAACAATTAGATCTAGTCAGG - Intronic
1055228764 9:74034488-74034510 TAAAATCATTTGATAAAGTCTGG - Intergenic
1055314288 9:75018445-75018467 CACCAAAATTTGATATAGTCAGG - Intronic
1055925324 9:81504422-81504444 CAATATAATTAGCTAAAATCAGG - Intergenic
1059582026 9:115560310-115560332 CAAAATTAATAGATATATACAGG + Intergenic
1202798138 9_KI270719v1_random:146065-146087 CAAAACAATTAGAAATAGCATGG + Intergenic
1188157740 X:26761239-26761261 CAAAAAAATTATATATAATCAGG + Intergenic
1188602074 X:31979350-31979372 CAAAATAATGAAATTTAGGCTGG - Intronic
1188944105 X:36276844-36276866 CAAAATTATTAAATATAGGATGG + Intronic
1189055385 X:37694243-37694265 CATAATAATTAGAGACAGACAGG - Intronic
1189627639 X:42916089-42916111 CAAAAGCATTTGATATAGTTTGG - Intergenic
1190220182 X:48508009-48508031 CAAAATAAATAAATAAAGACTGG - Intergenic
1190495675 X:51026519-51026541 CAATATAATTTTATATAGCCAGG - Intergenic
1190831098 X:54060219-54060241 AAAAATTATTAAATATAGGCTGG + Intergenic
1191056996 X:56252309-56252331 AAAAATAGTTAGAAATTGTCTGG - Intronic
1191221575 X:57993905-57993927 CAAAATAATTAGAAATCCACAGG - Intergenic
1193484734 X:82072569-82072591 CAAAATAATTAGAGAAAGGGAGG - Intergenic
1194605054 X:95968085-95968107 AACAATAATTAGAAATAGTGTGG - Intergenic
1196114217 X:111981841-111981863 CAAACTTATTAGATATGGTTTGG + Intronic
1196485468 X:116202330-116202352 CAAAATAATTAAAAATAATCAGG - Intergenic
1196934129 X:120712766-120712788 GGAAATAATTAAATCTAGTCCGG + Intergenic
1197193877 X:123678900-123678922 CAATATATGTAGATATAGTTGGG - Intronic
1199109398 X:143912010-143912032 AAAAATAAGTTGATATAGTTTGG - Intergenic
1201148446 Y:11080450-11080472 ATAAATAAATATATATAGTCTGG + Intergenic
1201342134 Y:12945816-12945838 AAAAAAAATTAGACATAGCCAGG - Intergenic