ID: 974874394

View in Genome Browser
Species Human (GRCh38)
Location 4:67685597-67685619
Sequence GTTTCCAACACACAAACTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 1, 2: 14, 3: 131, 4: 539}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874394_974874404 22 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874394_974874400 6 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874400 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 0
4: 11
974874394_974874402 9 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874402 4:67685629-67685651 GTTACGTAGGACCTAATGGGAGG No data
974874394_974874406 26 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874394_974874398 5 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874398 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG No data
974874394_974874405 23 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874394_974874396 -4 Left 974874394 4:67685597-67685619 CCCGGAGTTTGTGTGTTGGAAAC 0: 1
1: 1
2: 14
3: 131
4: 539
Right 974874396 4:67685616-67685638 AAACTTAAACCCCGTTACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874394 Original CRISPR GTTTCCAACACACAAACTCC GGG (reversed) Intronic
900017475 1:162668-162690 GTTTCCAGCACATAAACTTTGGG + Intergenic
900047734 1:521264-521286 GTTTCCAGCACATAAACTTTGGG + Intergenic
900069948 1:763128-763150 GTTTCCAGCACATAAACTTTGGG + Intergenic
900724008 1:4202983-4203005 GTCTCCAACAGAAAAACTCCTGG - Intergenic
902143444 1:14376275-14376297 GCTTCCAACACATAAACTTTGGG - Intergenic
902415104 1:16233821-16233843 GTTTCCAACACATGAACTCTGGG - Intronic
903394122 1:22986255-22986277 GTTTCCAACACACTAATTTTGGG - Intergenic
903842240 1:26251687-26251709 GTTTCCAACACATGAACTTTTGG + Intronic
906532720 1:46532806-46532828 TTTTCCATCTCCCAAACTCCTGG - Intergenic
906629909 1:47357906-47357928 GTTTCCAACACAGGAACTTGGGG + Intronic
906716477 1:47973440-47973462 GTTGCCAACAAACGAATTCCAGG + Intronic
907622490 1:55995749-55995771 GTTTCCAACATACAAAATTTGGG + Intergenic
907843898 1:58185909-58185931 GTATCCACCACACAAACTCTAGG - Intronic
908682514 1:66677983-66678005 ATTTCCAACAAACAACCTCTTGG - Intronic
908862208 1:68502022-68502044 ATTACCAACAAAAAAACTCCAGG + Intergenic
909206002 1:72758746-72758768 GTTTCCAACACATAAAGTTTGGG + Intergenic
909542405 1:76805818-76805840 GTTTCCAACACATAAACTTTGGG - Intergenic
909673919 1:78218067-78218089 GTTACCAACAAAAAAAATCCAGG + Intergenic
910219395 1:84875349-84875371 GTTTCCAACACATGAACTCTGGG - Intronic
910688847 1:89945504-89945526 GTTTCCAATACATAAACTTTGGG + Intergenic
911799701 1:102120895-102120917 GTTGCCAACACACAGTCTCCAGG - Intergenic
912469926 1:109899635-109899657 GTTTCCAACACATGAACTTTTGG + Intergenic
914454011 1:147818567-147818589 GTTTCCAACACATGAACTTTGGG + Intergenic
915110327 1:153560537-153560559 GTTTCCAACACATGAACTTTGGG + Intergenic
915620412 1:157079349-157079371 TTCTCCAACACACACCCTCCAGG - Intergenic
915999088 1:160597304-160597326 GTTTCCAACATACAAATTTTGGG - Intergenic
917862623 1:179161781-179161803 GTTTCTAACATACAAACTTTGGG - Intronic
918327977 1:183428263-183428285 GTTTCCAACACATGAACTTTGGG - Intergenic
918387174 1:184021322-184021344 GTTTCCAACACATGAACTTTGGG - Intronic
918566311 1:185937510-185937532 GTTTTCAGCACACAAATTCAGGG + Intronic
919159491 1:193809473-193809495 GTTTCCAACACATAAACTTTGGG - Intergenic
919161823 1:193840355-193840377 GTTTCCAACACATGAACTTCAGG + Intergenic
919344967 1:196363482-196363504 GTTTCCAACACATGAACTTTAGG - Intronic
919398425 1:197080137-197080159 GTTTCCAACATACGAACTTTGGG - Intergenic
919482316 1:198105658-198105680 GTTTCCAACACATTAACTTTGGG - Intergenic
919940505 1:202282873-202282895 GATTCCATCACACAAAGCCCAGG + Intronic
919965691 1:202522150-202522172 GTTTTCAACTCACAAACTCTTGG + Intronic
920041092 1:203097865-203097887 GTTTCCAACACATGAACTTTGGG + Intronic
920780536 1:208986911-208986933 GTTTCCAACACATGAACTTTGGG - Intergenic
920780546 1:208987055-208987077 GTTTCCAACACATGAACTTTGGG - Intergenic
921072951 1:211677106-211677128 GTTTCCAACACATGAACTTTGGG - Intergenic
921104560 1:211963071-211963093 TTTTTCAAAACACCAACTCCTGG - Intronic
921125068 1:212170352-212170374 GTTTCCAACACATGAAATCTGGG - Intergenic
921496686 1:215851552-215851574 GTTACCAACAAAAAAAGTCCAGG + Intronic
921910504 1:220544261-220544283 GTTTCCAACACACAAACTTTTGG - Intronic
921947971 1:220900404-220900426 CTTTTCAACAAACCAACTCCTGG + Intergenic
921969117 1:221125851-221125873 GTTTCCAACACACAAATTTTGGG - Intergenic
922105320 1:222508585-222508607 GTTTCCAGCACATAAACTTTGGG + Intergenic
922265654 1:223981164-223981186 GTTTCCAGCACATAAACTTTGGG + Intergenic
922577741 1:226674040-226674062 GTTGCCACCCCACTAACTCCGGG + Intronic
923501282 1:234567042-234567064 GTTTCCAACACATAAACTTTGGG - Intergenic
923755055 1:236784699-236784721 GTTTCCAACACACGAACTTTGGG + Intergenic
923838524 1:237642044-237642066 GTTTCAAACTCTCAAACTCTGGG - Intronic
923880619 1:238100278-238100300 GTTTCCAACATATAAACTTTGGG + Intergenic
923965482 1:239134236-239134258 GTGCCCCACACACAAACACCAGG + Intergenic
924347492 1:243086116-243086138 GTTTCCAGCACATAAACTTTGGG + Intergenic
924369562 1:243333430-243333452 GTTTCAAACACACTGACACCTGG - Intronic
924542421 1:244993916-244993938 GTTTCCAACACACGAACTTTGGG + Intronic
1063345938 10:5312479-5312501 GTTTCCAACACATGAAATCTGGG + Intergenic
1063473471 10:6307783-6307805 GTTTCCAACACATGAACTTTGGG - Intergenic
1064114025 10:12562369-12562391 GTTTCCAACACATGAACTGTTGG + Intronic
1064326963 10:14360278-14360300 GCTTCCAACACATAAACTTTGGG + Intronic
1065065246 10:21956350-21956372 GTTTCCAACACATAAACTTTCGG + Intronic
1065393736 10:25211627-25211649 GTTCCTAACACACGAACTCTGGG + Intronic
1065906829 10:30262408-30262430 GTTTCCAACACATGGACTTCGGG + Intergenic
1066537861 10:36411016-36411038 GTTTCCAACACAGAAACGTTGGG - Intergenic
1066629707 10:37447120-37447142 GTTTCCAACACATAAACTTTGGG - Intergenic
1066728861 10:38418754-38418776 GTTTCCAGCACATAAACTTTGGG - Intergenic
1067913536 10:50371986-50372008 GTTTCCAACACGTGAACTCTGGG + Intronic
1068065277 10:52122361-52122383 GTTTCCAAGACATAAATTCTGGG + Intronic
1068153842 10:53169884-53169906 GTTTCCAACACATGAACTTTAGG - Intergenic
1068248851 10:54409678-54409700 GTTTCCAATACACAAAATTTGGG - Intronic
1068311912 10:55289724-55289746 GTTTCCAACACATGAACTGTTGG - Intronic
1069134117 10:64742696-64742718 GTTTCCAACACATAATCTTTTGG - Intergenic
1069155863 10:65030256-65030278 GTTTCCAACACATAAACTTTGGG - Intergenic
1069573848 10:69511508-69511530 CTTTTCAACACACCAGCTCCTGG + Intergenic
1072202296 10:93171428-93171450 ATTTCCAACACATAAACTTTGGG + Intergenic
1072646861 10:97262904-97262926 GTTGCCCAGACTCAAACTCCTGG - Intronic
1073304011 10:102488568-102488590 GGTTCCAGGACACAATCTCCTGG + Intronic
1073517681 10:104092067-104092089 GTTTCCAACACATGAACTTTGGG - Intergenic
1073784064 10:106868896-106868918 GTTTTCAAAAAACAAACTCCTGG - Intronic
1073988477 10:109236607-109236629 GTTTCCAAAACACAAAGTAAAGG + Intergenic
1074098931 10:110338143-110338165 GTTTCCAACACATGAACTTTGGG - Intergenic
1074319143 10:112384710-112384732 GTTCCCCAGACTCAAACTCCTGG + Intronic
1074984579 10:118646110-118646132 GTTACCAACAAAAAAAGTCCAGG - Intergenic
1075072283 10:119327202-119327224 GTATCCAGCACACACACACCAGG + Intronic
1075145222 10:119876970-119876992 GTTTCCAACACCCAAACTCTGGG - Intronic
1075586681 10:123663601-123663623 GTTTCCAACACATGAACTTTGGG + Intergenic
1075932274 10:126309416-126309438 GTTTACAATACCCAAAGTCCAGG - Intronic
1076221655 10:128738662-128738684 GTTATTAACACACAAACTCAGGG + Intergenic
1076251586 10:128988259-128988281 GTTCCCAACACACAAACTTTGGG + Intergenic
1076338979 10:129729514-129729536 GATTCCATCACTCAAAATCCAGG + Intronic
1076974072 11:157874-157896 GTTTCCAGCACATAAACTTTGGG + Intergenic
1077904058 11:6515151-6515173 GTTTCCAACACATTAACTTTTGG + Intronic
1078329248 11:10405870-10405892 GTTATCAACCGACAAACTCCAGG - Intronic
1078414284 11:11152665-11152687 GTTTCCAACACATGAACTCTGGG + Intergenic
1078468905 11:11571320-11571342 GTTTCCACCACACAAAGTCAGGG - Intronic
1078636181 11:13052564-13052586 TTTTTCAATACACAATCTCCTGG - Intergenic
1078732165 11:13984655-13984677 GTTTCCAACACATAAACTTTGGG + Intronic
1079530213 11:21443337-21443359 GTTTCCAACACATGAACTTTAGG + Intronic
1079877770 11:25881329-25881351 GTTTCCAACACACGAAATTTCGG - Intergenic
1079920990 11:26434364-26434386 TTTTTCAAAAAACAAACTCCTGG + Intronic
1081266801 11:41034095-41034117 GTTTCCAACACATAAACATTTGG - Intronic
1084502539 11:69543441-69543463 GTTTCCAACACATGAACTTTTGG - Intergenic
1084559822 11:69897474-69897496 GTTTCCAGCACATGAACTTCAGG + Intergenic
1084616929 11:70242643-70242665 GTTTCCAACACATGAACTTTGGG + Intergenic
1085064514 11:73481789-73481811 GTTTCCAACACATAAATTTTGGG - Intronic
1085956598 11:81405350-81405372 GTTTCCAACACGCTAACTTTGGG - Intergenic
1086804865 11:91227895-91227917 GTTTCTTACAAATAAACTCCAGG + Intergenic
1087320832 11:96656278-96656300 GTTTAGAACAGCCAAACTCCAGG + Intergenic
1087775524 11:102253311-102253333 GTTTCCAACACGTGAACTCTGGG + Intergenic
1087917512 11:103828437-103828459 GTTTCCAACACATGAACTTTAGG - Intergenic
1088181515 11:107118039-107118061 GTTTCCAACACATGAACTGTGGG - Intergenic
1088566425 11:111177683-111177705 GTTTCCAACACATGAAATCTGGG + Intergenic
1088759556 11:112916234-112916256 GTTTCCAACACATAAACTTTGGG + Intergenic
1088922034 11:114266661-114266683 GTTTCCAACACATAAACTTCTGG - Intronic
1089107238 11:116023216-116023238 GTTTCCAACACATGAACTTTGGG - Intergenic
1090065398 11:123499089-123499111 GTTTCCAACACATAAATTTTGGG - Intergenic
1090148392 11:124354186-124354208 GTTTCCAACACATAAAATTTGGG - Intergenic
1090559218 11:127912153-127912175 GTTACCAACAAAGAAAGTCCAGG - Intergenic
1090903743 11:131055530-131055552 GTTTCCAACACATAAATTTTGGG + Intergenic
1091159005 11:133402383-133402405 GTTTCCAAAACATAAACTTTGGG + Intronic
1091451394 12:574401-574423 GTTTCCAACCCATAAACTTTAGG - Intronic
1092719340 12:11425300-11425322 GTTTCCAAGAGACAGACTGCAGG + Intronic
1093538823 12:20255985-20256007 GTTTCCAACACATAAACTTTGGG + Intergenic
1093734240 12:22601922-22601944 GTTTCCAACATATGAACTTCAGG - Intergenic
1094395759 12:30003636-30003658 GTTTCCTACACATAAACTTTGGG - Intergenic
1094530338 12:31268528-31268550 GTCTCAAACTCTCAAACTCCTGG + Intergenic
1095136108 12:38605935-38605957 GTTTCCAACACATGAACTTTGGG + Intergenic
1095326151 12:40895672-40895694 GTTTCCAACACATGAAATCTGGG + Intronic
1095441944 12:42246427-42246449 GTTCCCATCACACTAATTCCTGG - Intronic
1095893217 12:47254215-47254237 ATTTCCAACAAAAAAAGTCCAGG + Intergenic
1096174209 12:49501495-49501517 GTTTCCAACACACGAGCTTTGGG + Intronic
1097721247 12:63023901-63023923 GTTTCCAACACATGAACTGCGGG - Intergenic
1098115451 12:67171728-67171750 GTTTCCAACACATGAACCTCGGG - Intergenic
1098947219 12:76602174-76602196 GTTTCCAACACATGAACTTTGGG + Intergenic
1099012837 12:77312423-77312445 GTTTCTAACACATAAACTTTGGG + Intergenic
1099111882 12:78572233-78572255 GTTTCCCTCACACTATCTCCTGG - Intergenic
1099810865 12:87580488-87580510 GTTTCCAACACATGAACTTTGGG + Intergenic
1100473817 12:94917302-94917324 ATTTCCACCACCCAAACTGCTGG - Intronic
1100957248 12:99922684-99922706 GTTCCCAACACATGAACTTCGGG - Intronic
1101193790 12:102362009-102362031 GTTTCTAACATATAAACTTCTGG + Intergenic
1102437414 12:112936124-112936146 GTTTCCAACACATGAATTCTGGG + Intergenic
1103093536 12:118114856-118114878 GTTTCCAACACATGAACTTTTGG - Intronic
1103190174 12:118994390-118994412 GCTTCCACCACAGAGACTCCCGG + Intronic
1104157329 12:126146298-126146320 CTTTCCAACACATAAACTTTGGG + Intergenic
1104388592 12:128372848-128372870 GTTTTAAACGTACAAACTCCAGG - Intronic
1106233145 13:27838256-27838278 GTTTCCAACAGACAAACTTCAGG - Intergenic
1106652694 13:31708667-31708689 GTTTTCAACACACAAAATCTGGG + Intergenic
1106656201 13:31749460-31749482 CATTCCTACACACATACTCCTGG + Intronic
1107019304 13:35735298-35735320 ATTTCCAACACATAAACTTTGGG + Intergenic
1108005604 13:45942878-45942900 GTTTCCAACACATGAACTTTGGG - Intergenic
1108161437 13:47644562-47644584 GTTTCCAACACATACATTCTGGG - Intergenic
1108582034 13:51836058-51836080 GTTTCCAACACATGAACTTTGGG - Intergenic
1108805690 13:54152906-54152928 GTTTCCAACACATGAACTTTAGG + Intergenic
1109720736 13:66273147-66273169 GTTTCCAACCCATAAACTTTGGG - Intergenic
1110046076 13:70832897-70832919 ATTTTCAACACACATACTCTAGG + Intergenic
1110245991 13:73325175-73325197 ACTTCCGACGCACAAACTCCAGG + Intergenic
1110439935 13:75516655-75516677 GTTTCCAACACATGAACTTTGGG - Intergenic
1113099284 13:106699596-106699618 GTTTACAGCACAGAAACTCGAGG - Intergenic
1113961291 13:114127696-114127718 GTCTCCAACTCTCCAACTCCAGG - Intronic
1114653588 14:24302415-24302437 GTTTCCAACTCACCAGCTCAGGG - Exonic
1114795440 14:25710270-25710292 GTTTCCAATACATAAACTTTGGG + Intergenic
1115057572 14:29149163-29149185 GTTTACAAAACACTAACTGCAGG + Intergenic
1115444452 14:33473147-33473169 GTTTCCATCAGCCAACCTCCCGG - Intronic
1116125445 14:40778408-40778430 GTTTCCACCCCACTAACTCTGGG - Intergenic
1116312453 14:43343395-43343417 GTTTTCAAAAAACAAGCTCCTGG + Intergenic
1116526641 14:45914795-45914817 GTTTCCAACACATGAACTTCTGG - Intergenic
1117030484 14:51664017-51664039 GTTTCCAACACATGAACTTTTGG + Intronic
1117143480 14:52812942-52812964 GTTTCCAACACATGAACTTTTGG - Intergenic
1117202494 14:53406613-53406635 GTTTCCAACACATGAACTTTGGG - Intergenic
1117266875 14:54098199-54098221 GTTTCCAACACATAAATTTGGGG + Intergenic
1117391697 14:55268678-55268700 GTTTCTAACACATAAACTTTGGG + Intergenic
1117435500 14:55712081-55712103 GTTTCCAACACATGAACTTCGGG - Intergenic
1117668257 14:58079539-58079561 GCTTCCAACACATAAATTTCGGG + Intronic
1117833279 14:59776196-59776218 GTTTCCAACACATGAACTTTGGG - Intronic
1117851962 14:59982632-59982654 GTTTCCAACACATGAACTTTTGG + Intronic
1118388580 14:65277621-65277643 GTTTCCAACACAAGAACTTTAGG - Intergenic
1118825336 14:69375037-69375059 GTTTCCAACACATAAACTTTGGG + Intergenic
1119533172 14:75377846-75377868 GTTTCCAACACATAAACTCTGGG - Intergenic
1122285516 14:100649595-100649617 GTTCCCAAGACACAAACTTTGGG - Intergenic
1124347645 15:28933207-28933229 GTTTCCAACACATGAACTTTGGG + Intronic
1124508874 15:30305392-30305414 GTTTCCAACACATGAACTTTGGG + Intergenic
1124591362 15:31056583-31056605 GTTTCCAACACAAGAACTTTGGG - Intronic
1124734684 15:32233270-32233292 GTTTCCAACACATGAACTTTGGG - Intergenic
1125255047 15:37753576-37753598 GTTTCCAACACATGAACTTTGGG + Intergenic
1126173261 15:45711998-45712020 ATTTTCAACACATAAACTTCTGG + Intergenic
1126882679 15:53116222-53116244 GTTTCCAACACATAAATTTAAGG - Intergenic
1127007917 15:54591417-54591439 GTTACCAACAAAAAAAGTCCAGG - Intronic
1127143538 15:56001815-56001837 ATTTCCAACACATAAACTTTGGG - Intergenic
1127940325 15:63688815-63688837 GTTTCCCAAACGCAAATTCCTGG - Intronic
1128230554 15:66031778-66031800 GTTTCCAACACACGAACTTTTGG - Intronic
1128230959 15:66034745-66034767 GTTTCCAACACATAAACTTTTGG - Intronic
1128303764 15:66584256-66584278 GTTTCCAACACACAAACTTTGGG - Intronic
1128564084 15:68687961-68687983 GTTTCCAACACATGAACTCTGGG + Intronic
1128751252 15:70151534-70151556 GTTTTCAACACACAAACTTTGGG - Intergenic
1129118622 15:73381072-73381094 GTTTCCAACACACAAACTTCAGG + Intergenic
1129632181 15:77272622-77272644 GTTACCAACAAAAAAAGTCCAGG + Intronic
1129786008 15:78310607-78310629 GTTTCCAACACACGAACTTTGGG + Intergenic
1130921163 15:88345824-88345846 GATTTCAACATACAAACTCTAGG + Intergenic
1131372997 15:91899104-91899126 GGTTTCAACATACCAACTCCTGG + Intronic
1131518866 15:93098543-93098565 GTTTCCAACACATGAACTTTGGG + Intergenic
1131784753 15:95900055-95900077 TTTTCCAACTAAGAAACTCCCGG - Intergenic
1131861997 15:96663658-96663680 GTTTCCAACACATGAACTTTGGG - Intergenic
1132736843 16:1390421-1390443 GTTTCAAACAGACAAACACGGGG + Intronic
1133003487 16:2863854-2863876 GTTTCCAACACATGAACTTTGGG - Intergenic
1133189700 16:4124515-4124537 TTTTCAAACAGAAAAACTCCAGG + Intergenic
1133852186 16:9515955-9515977 GTTTCCAACACATGAACTTTGGG + Intergenic
1134038519 16:11050307-11050329 GTTTCCAACACATGAACTATGGG + Intronic
1134334064 16:13278544-13278566 ATTACCAACAAAAAAACTCCGGG - Intergenic
1134899920 16:17928177-17928199 GATTCCAACATATAAACTCTGGG + Intergenic
1135160591 16:20091897-20091919 GTTTTCAACACATAAACTTTGGG + Intergenic
1135272416 16:21080851-21080873 AATTCTCACACACAAACTCCAGG + Intronic
1135383616 16:22015287-22015309 GTTTCCCAGGCTCAAACTCCTGG + Intronic
1135754294 16:25083651-25083673 GTTTCCAACACATGAACTTTGGG - Intergenic
1136623855 16:31449377-31449399 GTTTCCAACACATGAACTTTAGG + Intergenic
1136627256 16:31469387-31469409 GTTTCCAACACATGAACTCTGGG - Intergenic
1136666037 16:31813795-31813817 CTTTCCAAAACACCAGCTCCTGG - Intergenic
1137989855 16:53143153-53143175 GTTTCCAACACCTAAACTTTGGG + Intronic
1138259936 16:55610707-55610729 TTTTCCCAAAAACAAACTCCTGG + Intergenic
1138493277 16:57390648-57390670 GTTTCCAACACACAAACTTTTGG - Intergenic
1140391716 16:74592849-74592871 GTTTCCAACACATGAACTTTGGG - Intronic
1140584118 16:76268406-76268428 GTTTCCAACATACGAACTTTGGG - Intergenic
1142162149 16:88563320-88563342 GTTCCCAACACATAAAGTCTAGG + Intergenic
1142446186 16:90139789-90139811 GTTTCCAGCACATAAACTTTGGG - Intergenic
1142461319 17:95674-95696 GTTTCCAGCACATAAACTTTGGG + Intergenic
1142541746 17:665040-665062 GTTTCCAACACATGAACTTTGGG - Intronic
1144195348 17:12889558-12889580 GTTTCCAACACAGGAACTTCAGG + Intronic
1144254566 17:13453936-13453958 TTTTCCAACCCCCAAACTCCTGG + Intergenic
1146529980 17:33600195-33600217 GTTTCCAACACATCAACTTTGGG - Intronic
1146730149 17:35186229-35186251 ATTTCCAACACATGAACTCTGGG + Intronic
1147029132 17:37616433-37616455 GTCTCGAACTCTCAAACTCCTGG - Intronic
1147491878 17:40876914-40876936 GTTTTCCACACATGAACTCCAGG - Intronic
1147965851 17:44193856-44193878 GCTTCCAACCCACAGCCTCCCGG + Exonic
1147985598 17:44305878-44305900 GTTTCCAACACATGAACTTCGGG + Intergenic
1148253390 17:46106252-46106274 AGTTCCAACGCACAATCTCCAGG + Intronic
1150014871 17:61544048-61544070 GTCTCAAACTCTCAAACTCCTGG + Intergenic
1150390620 17:64788123-64788145 GTTTCCACCACACCAACGGCAGG + Intergenic
1150430216 17:65109313-65109335 GTTTCAAACACACAAACTTTTGG + Intergenic
1150517784 17:65832400-65832422 TTTTCCAAAAAACAAACTCCTGG - Intronic
1150686874 17:67327965-67327987 GTTTCCAACACATGAACTTTGGG - Intergenic
1150967201 17:69984809-69984831 GTTTCCAATACAAAAACTTTGGG + Intergenic
1151704040 17:75757477-75757499 GTGTCCGGCTCACAAACTCCTGG - Exonic
1151835394 17:76579570-76579592 GTTTCCAACACATAAACTTTGGG - Intronic
1153433266 18:5041604-5041626 GTTTCCAACACATGAATTTCTGG - Intergenic
1153680219 18:7493433-7493455 GTTTCCAACACATGAACTCCAGG + Intergenic
1155627094 18:27846822-27846844 CTTTTCAACACACAAACTTGGGG + Intergenic
1155874640 18:31070739-31070761 GTATCAAACACAGAAGCTCCTGG - Exonic
1156111714 18:33735576-33735598 GCTTCCAAAACACAGACTCCTGG - Intronic
1156148301 18:34213183-34213205 GTTTCCAACACAGGAACTTCGGG - Intronic
1156244097 18:35281347-35281369 CAGTCCAACAAACAAACTCCAGG + Intronic
1156386334 18:36608484-36608506 GTTTCCAACACATGAACTTTGGG + Intronic
1156737839 18:40283407-40283429 GTTTCCTAAACACAATCTCTGGG - Intergenic
1157670676 18:49525893-49525915 GTTCCCAACACACAAACTGTTGG - Intergenic
1157687185 18:49651803-49651825 GTTGCCTTCACACAAACCCCAGG - Intergenic
1158358029 18:56641850-56641872 GATACCAACAGAGAAACTCCGGG + Intronic
1159270287 18:66140380-66140402 GTTTCCAACACATGAACTTTGGG + Intergenic
1159569329 18:70094232-70094254 TTTTCCAAAACACCAGCTCCTGG + Intronic
1159606795 18:70482853-70482875 TTTTTCAAAACACAAACTCCTGG + Intergenic
1159630065 18:70739038-70739060 GTTTTCAAAACACCAGCTCCTGG - Intergenic
1159700617 18:71622188-71622210 GTTTCCAACATGCAAACTTTGGG - Intergenic
1159868520 18:73734332-73734354 GTCTGCAACTCAAAAACTCCTGG + Intergenic
1159942787 18:74421322-74421344 GTTTCCAACACATGAACTTTGGG - Intergenic
1160651020 19:228041-228063 GTTTCCAGCACATAAACTTTGGG + Intergenic
1164157601 19:22605959-22605981 GTCCCCAACACACAAACTCCAGG - Intergenic
1165521377 19:36316877-36316899 GTTTCCAACACATGAACTTTGGG + Intergenic
1165622684 19:37261712-37261734 GTTTCCAACACATGAACTTCGGG - Intergenic
1165634388 19:37328346-37328368 GTTTCCAACACATGAACTTTGGG - Intronic
1165994620 19:39834940-39834962 GTTTCCAACACATGAACTTTGGG - Intronic
1166030472 19:40121881-40121903 GTATCAACCCCACAAACTCCAGG - Intergenic
1166051162 19:40261118-40261140 GTTTCCAACACATGAACTTTGGG - Intronic
925055523 2:854087-854109 GTTTCCAACACACAAACATTGGG - Intergenic
925258711 2:2511491-2511513 GTTTCCAACACATCAACTTTGGG - Intergenic
925373831 2:3367460-3367482 GTTTCCAACACAGAAACAGAAGG + Intronic
925749569 2:7075411-7075433 GTTTCCAACACACGAAATTTTGG - Intergenic
926283780 2:11471439-11471461 GTTTCCAACACATGAATTCTGGG + Intergenic
926402343 2:12510705-12510727 GTTTCCAGCACATAAACTTTGGG - Intergenic
927059635 2:19404264-19404286 GTTTCTAACACAGAAATTCCTGG - Intergenic
927573238 2:24178353-24178375 GTCTCAAACTCTCAAACTCCTGG - Intronic
927776346 2:25906775-25906797 GTTTTCAACACATGAACTTCTGG - Intergenic
927828573 2:26327961-26327983 GTTTCCAACACATGAACTTTGGG + Intronic
928929284 2:36607355-36607377 GTTTCCAACACATAAACTTTAGG + Intronic
929027953 2:37623418-37623440 GTTTCCAACACATGAAATCTGGG - Intergenic
929493819 2:42422160-42422182 CTTTCCAACACATAAACTTTGGG - Intronic
930259319 2:49126500-49126522 GTTTCCAACACATAAACTTTGGG + Intronic
930345889 2:50180440-50180462 GTATCCAACACACATATTCTGGG - Intronic
930402543 2:50908689-50908711 GTTTTCAACACACAAAATTTGGG - Intronic
931165094 2:59738316-59738338 GTTTCCAACACACAAATTTTAGG + Intergenic
931861533 2:66359844-66359866 GTTTCCAACACATGAACTCTGGG - Intergenic
933598048 2:84302495-84302517 GTTTCCAACACATGAACTTTGGG + Intergenic
933802604 2:85975090-85975112 GTTACCACCTCACAAACCCCAGG - Intergenic
934912424 2:98271876-98271898 GTTTCCAACACATGAACTCTGGG - Intronic
935051202 2:99526419-99526441 GTTTCCAACACATGAACTCTAGG + Intergenic
935560138 2:104550901-104550923 GTTTCCAACACATGAACTTTAGG + Intergenic
935667060 2:105522000-105522022 GTTTCCAACACATAAAATTTAGG + Intergenic
936045238 2:109182433-109182455 ATTTCCAACACATAAACTTTGGG + Intronic
936275659 2:111094682-111094704 GTTTTCAACACATAAACTTTGGG + Intronic
936643980 2:114348085-114348107 GTTTCCAACATACAAATTTTAGG + Intergenic
936752227 2:115658951-115658973 GTTTCCAACACATAAACTTTGGG - Intronic
939769846 2:146301885-146301907 ATTTCCAACAGAAAAAGTCCAGG + Intergenic
941631336 2:167888081-167888103 GTTACCAACAAAAAAAGTCCAGG - Intergenic
941685926 2:168448707-168448729 ATTTCCAACACACAAACTTTTGG - Intergenic
942483163 2:176411277-176411299 GTTTCCAACACATGAACTTTGGG + Intergenic
943129180 2:183836434-183836456 GTTTCCAACACACGAACTTTAGG + Intergenic
943136579 2:183920479-183920501 GTTTCCAATACATAAACTTTTGG + Intergenic
943330181 2:186549628-186549650 GTTTCCAACACATAAACTTTGGG + Intergenic
943631505 2:190257910-190257932 GTTTCCAACACGTGAACTTCAGG + Intronic
944430656 2:199630049-199630071 GTTTCCAACACATGAACTTTGGG - Intergenic
945964647 2:216173624-216173646 GTTTCCAACACATAAACTTTGGG - Intronic
945991353 2:216397992-216398014 GTTTCCAAAACACCAACTTTGGG - Intergenic
946296456 2:218787542-218787564 GTTTCCAACACATGAACTTTAGG - Intronic
946582789 2:221148602-221148624 GTTTCCAACACATTAACTTTGGG - Intergenic
947036453 2:225863653-225863675 GTTTCCAACACATGAACTTTGGG - Intergenic
947404457 2:229760473-229760495 GTTTCCAACACATGAACTTTTGG - Intergenic
947540625 2:230975087-230975109 GTTTCCAACACATGAACTTTGGG + Intergenic
947966359 2:234284915-234284937 GTTGCCAACACACGAACTTTGGG - Intergenic
948280698 2:236745748-236745770 ATTTAGAAGACACAAACTCCTGG - Intergenic
948995850 2:241578030-241578052 GTTTCCAACACATGAACTTTTGG - Intergenic
1168863974 20:1068441-1068463 GTTTCCAACACACACATTTTGGG + Intergenic
1169185286 20:3610803-3610825 GTCTCAAACTCTCAAACTCCTGG + Intronic
1170318915 20:15072835-15072857 GTTTTCAACACACAAACTTTGGG - Intronic
1172398097 20:34624147-34624169 GTTCACTACACTCAAACTCCTGG + Intronic
1172500821 20:35425862-35425884 GTTTCCAACACATGAACTTTTGG - Intergenic
1173912689 20:46681997-46682019 GTTTCCAACACATGAAATACGGG + Intronic
1174231967 20:49052885-49052907 GTCTTAAACACCCAAACTCCTGG - Intronic
1174401619 20:50278923-50278945 GTTTCCAAGACGCCAACTCCAGG - Intergenic
1174681425 20:52412477-52412499 GTTTCCAACGCATGAACTTCTGG - Intergenic
1174831176 20:53813500-53813522 GTTTCCAACATACGAACTTTGGG - Intergenic
1174871996 20:54191641-54191663 GTCTCCAACACAGAACTTCCCGG + Intergenic
1177185185 21:17785816-17785838 GTTTCCAACACATGAACTTCAGG + Intergenic
1177324671 21:19568948-19568970 GTTTCCAACACATGAACTTTGGG + Intergenic
1177478534 21:21655314-21655336 ATTTCCAACACATAAATTCTGGG + Intergenic
1177946642 21:27478993-27479015 GTTTCCAACACATGAATTTCGGG + Intergenic
1178053246 21:28770500-28770522 GTTTCTAACACACAAACTTTGGG - Intergenic
1178135849 21:29626376-29626398 GTTTCCAACACATGAACTCTGGG + Intronic
1178612385 21:34095648-34095670 GATTCCAACCCAAAGACTCCTGG - Exonic
1178666068 21:34547555-34547577 GTTTCTAACACATAAACTTTTGG - Intronic
1178903207 21:36614282-36614304 GTTTCCAACACATGAACTTGGGG - Intergenic
1179073992 21:38100697-38100719 CTTTCTAACACCCAAACCCCTGG - Intronic
1179254497 21:39703544-39703566 GTTTCTAACACATAAACTTTGGG - Intergenic
1179502448 21:41818683-41818705 GTTTCCAACACACTGTCACCGGG + Intronic
1181899538 22:26141822-26141844 CTTTCTAATACACGAACTCCAGG + Intergenic
1182118256 22:27770395-27770417 TTTTCCAACACATAAATTTCTGG + Intronic
1182768819 22:32778810-32778832 GAAAGCAACACACAAACTCCAGG + Intronic
1183017533 22:35001538-35001560 GTTGCCCAGACTCAAACTCCTGG - Intergenic
1183497801 22:38159371-38159393 GCTTCCCACAAATAAACTCCAGG + Intronic
1183973102 22:41493243-41493265 GTTGCCAACACATAAACTTTGGG + Intronic
1184007291 22:41719648-41719670 GTTTCCAACACATGAACTTTGGG + Intronic
1184385884 22:44174294-44174316 GCTTCCACCACACCATCTCCAGG - Intronic
1185145784 22:49135780-49135802 TTTTCCTAAACAGAAACTCCAGG + Intergenic
949618830 3:5787137-5787159 GTTTCCAACACATGAACTTATGG - Intergenic
949743228 3:7260632-7260654 TTTTTCAAAAAACAAACTCCTGG + Intronic
949917919 3:8979233-8979255 GTTTCCAACACATAAATTTGGGG - Intergenic
950713113 3:14827984-14828006 GTGGCCCAAACACAAACTCCTGG - Intronic
950896612 3:16457790-16457812 GTTTCCAACACATAAATTTGGGG - Intronic
951272744 3:20647167-20647189 GTTTCAAACACATGAACTCTGGG - Intergenic
951523102 3:23627601-23627623 GTTTCCAACACACAAAATTTAGG + Intergenic
951961022 3:28320544-28320566 GTTTCCAACACATGAACTCTTGG + Exonic
952327875 3:32337205-32337227 GTTTCCAACACATAAAGTTTGGG + Intronic
952808877 3:37383885-37383907 GTTTCCAACACACAAATTTTGGG - Intergenic
953148314 3:40300281-40300303 GCTTCTAACACACAAACTTTAGG + Intergenic
953731212 3:45449607-45449629 GTTTCCAACACATGAACTTTGGG + Intronic
953898867 3:46826888-46826910 GTTTCCAACACATGAACTTTGGG - Intergenic
954577500 3:51684647-51684669 GTCCCCAACACACACACCCCAGG - Intronic
954643538 3:52116688-52116710 GTTTTGAACACATAATCTCCTGG + Intronic
955137577 3:56234911-56234933 GTTTCCAACACATAAATTTAGGG + Intronic
955639394 3:61066263-61066285 GTTTCCAAAACATAAACTCTGGG + Intronic
956256011 3:67283845-67283867 GATTCCAACACACGAACTTTGGG + Intergenic
957061614 3:75486388-75486410 GTTTCCAAAAAACCAGCTCCTGG + Intergenic
957122584 3:76114197-76114219 GTTTCCAACACATGAACTTTGGG + Intronic
957197291 3:77085615-77085637 GTTTCCAAGATACAAACTTCAGG + Intronic
957253933 3:77812312-77812334 GTTTCCAACACACGAAGTTTAGG + Intergenic
957835099 3:85577238-85577260 GCTTCCAACACATGAACTCCGGG - Intronic
957891277 3:86362398-86362420 GTTTCCAACACATGAAATCTGGG + Intergenic
959131399 3:102361136-102361158 GCTTTGAACACACAAATTCCTGG + Intronic
959424094 3:106164772-106164794 ATTTCCAACAAAAAAAGTCCAGG + Intergenic
960145731 3:114199536-114199558 ATTTCCAACACACAAACTTTGGG + Intergenic
962067571 3:131998032-131998054 GTTTCCAACACATGAACTTTGGG + Intronic
962487908 3:135862855-135862877 GTTTCCAACACATGAACTTACGG - Intergenic
962534015 3:136310517-136310539 GTCTCAAACAAACAAACACCAGG + Intronic
962803052 3:138906602-138906624 GTTTCCAACACATGAACTTCGGG + Intergenic
964578968 3:158209158-158209180 GTTTCCAACACAAAAACTTTGGG - Intronic
965058406 3:163751343-163751365 ATTTCAAACACACAAACTACTGG + Intergenic
965364151 3:167777792-167777814 GTTTCCAACACGTAAACTTTTGG - Intronic
965748231 3:171947893-171947915 TTTTTCAAAAAACAAACTCCTGG + Intergenic
966555635 3:181257376-181257398 GTTTCCAACACATAAACTTTGGG + Intergenic
966762717 3:183431448-183431470 GTTTCCAACACATGAACTTTGGG - Intergenic
967121003 3:186383036-186383058 GATTCCAACACATGAACCCCAGG + Intergenic
967177241 3:186872395-186872417 GTTTCCAACACATAAATTTGGGG + Intergenic
968009323 3:195263337-195263359 ATTTCCAACACATGAATTCCAGG - Intronic
968205821 3:196799382-196799404 GTTTCTAACACATGAACTCTGGG - Intronic
968366810 3:198191946-198191968 GTTTCCAGCACATAAACTTTGGG - Intergenic
968963372 4:3757007-3757029 GGTTCCAACACAAACATTCCAGG + Intergenic
969134074 4:5015984-5016006 GTTTCCAACACATAAACTTTTGG - Intronic
969147196 4:5134223-5134245 GTTTCCAACACATAAACTTTGGG - Intronic
970152901 4:13108506-13108528 GTTTCTAACACATAAACTTTAGG + Intergenic
970576516 4:17434095-17434117 GTTTCCAACACATGAACTTTTGG + Intergenic
971302761 4:25455657-25455679 GTTTCCAACACATGAACTTTGGG + Intergenic
971360923 4:25937585-25937607 GTTTCCAACACATGAACCCTAGG + Intergenic
971590301 4:28459212-28459234 GTTTCCAGCACACAAAATATTGG - Intergenic
971820464 4:31547137-31547159 GTTTCAAACACATAAACTTTGGG - Intergenic
971993695 4:33935462-33935484 GTCTCCAACACACAAACTTTGGG - Intergenic
972370931 4:38422584-38422606 GTTTCCAACACATGAACTTTAGG + Intergenic
972815775 4:42643673-42643695 GTTTTCAACACACTGACCCCTGG - Intronic
973206925 4:47571204-47571226 GTTTCCAAAGCAAAAACTCCTGG + Intronic
973981729 4:56313679-56313701 GCTTCCAAGTCACAAGCTCCAGG + Intronic
974155822 4:58070878-58070900 GTTTCCAGCACATAAATTCTGGG - Intergenic
974355909 4:60812482-60812504 GTTTCCAACACATGAACTTTGGG + Intergenic
974481289 4:62447107-62447129 GTTTCCAACATACAAACTTTAGG - Intergenic
974514154 4:62886628-62886650 GTTTCCAACACATGAACTTTGGG - Intergenic
974874394 4:67685597-67685619 GTTTCCAACACACAAACTCCGGG - Intronic
975859886 4:78665609-78665631 GTTTCCAACACATGAACTTTGGG - Intergenic
975902652 4:79171123-79171145 GTTTCCAACACATGAACTTTTGG - Intergenic
976144611 4:82030186-82030208 GGTTCCAAAACATAAAATCCTGG + Intronic
976153937 4:82122354-82122376 GTTCCCAACACATGAACTTCGGG + Intergenic
976224093 4:82781547-82781569 GTTTCCAACACATGAACTTAGGG - Intronic
976633001 4:87258758-87258780 GTTTCCAACACATGAACTTTGGG - Intergenic
976785201 4:88811847-88811869 GTTTCTAACACATAAACTTTGGG - Intronic
976953464 4:90864315-90864337 GTTTCCAACACATGAACTTTGGG - Intronic
977192724 4:94021012-94021034 GTTTCCAACACATAAACTTTGGG - Intergenic
977288376 4:95136846-95136868 CTTTTCAAAACACCAACTCCTGG + Intronic
977590371 4:98819648-98819670 GTATCCAACACATAAACTTCGGG - Intergenic
977903919 4:102454661-102454683 GTTTCCAACACATGAAATCTGGG + Intergenic
977971814 4:103221704-103221726 TTTTCCAAAAAACCAACTCCTGG - Intergenic
978330246 4:107604629-107604651 GTTTCCAACACATGAACTTTGGG + Intronic
978524593 4:109652727-109652749 GTTTCCAACACATGGACTCTGGG + Intronic
978526772 4:109675628-109675650 GTTTCCAACACATCAACTTTGGG - Intronic
978535241 4:109755422-109755444 GTTTCCAACACATGAACTTTGGG - Intronic
978596513 4:110382986-110383008 TTTTCAAAAAAACAAACTCCTGG - Intronic
978628283 4:110712770-110712792 GTTTCCAACACATGAATTTCTGG - Intergenic
978723464 4:111942261-111942283 GTTTCCAACACATGAACTTTGGG + Intergenic
979072299 4:116223257-116223279 CTTTCCAACACAAACACACCAGG - Intergenic
979151431 4:117321053-117321075 GTCTCCAACATGCAAACTCTTGG - Intergenic
979255223 4:118601555-118601577 GTTTCCAGCACATAAACTTTGGG - Intergenic
979333113 4:119438953-119438975 GTTTCCAGCACATAAACTTTGGG + Intergenic
979705225 4:123712883-123712905 ATTTCCAACAAAAAAAGTCCAGG + Intergenic
980049438 4:128024388-128024410 GTTTCCAACACATGAACTTTGGG + Intronic
980311256 4:131132521-131132543 GTTTCCAACACATAAATTTTGGG - Intergenic
980451857 4:132984184-132984206 ATTTTCAACACACAAACTGTGGG - Intergenic
980501042 4:133654648-133654670 CTTTCTAAGACACAAATTCCTGG - Intergenic
980669506 4:135986244-135986266 GTTTCCAACCCATAAACTTTAGG + Intergenic
980694761 4:136340443-136340465 TCTCCCAACAAACAAACTCCTGG - Intergenic
980805183 4:137803198-137803220 GTTTTCAACATACAAACTCAAGG + Intergenic
981620749 4:146695761-146695783 GTTTCCAACACATGAACTTTTGG + Intergenic
981778264 4:148394994-148395016 ATTTCCAACCCACCAAATCCTGG - Intronic
981928517 4:150165769-150165791 GTTTCCAACACATGAACTTTTGG - Intronic
981961853 4:150550949-150550971 GTTTCCAACACATGAACTTTGGG - Intronic
982286958 4:153745908-153745930 GTTTCCAACACATGAACTTTGGG + Intronic
982787307 4:159550698-159550720 GTTTCCAACACATGAACTTTGGG + Intergenic
982977095 4:162077361-162077383 GTTTCCAACACATAAACTTTGGG + Intronic
982994239 4:162320298-162320320 GTTTCCAACACATGAACTTTGGG + Intergenic
983021583 4:162683250-162683272 GTTTCCAACACATGAACTTTGGG + Intergenic
983452839 4:167928846-167928868 GTTTGCAACACACAAATTTTGGG - Intergenic
983629034 4:169830756-169830778 GTTTTCAAAGAACAAACTCCTGG - Intergenic
983884882 4:172969737-172969759 GTTTCCAACACATGAACTTTGGG - Intronic
984103495 4:175515784-175515806 GTTTCCAACACATCAACTTTGGG - Intergenic
984221255 4:176979858-176979880 GTTTCCAACACGTAAACTTTTGG - Intergenic
984309499 4:178038695-178038717 GTTTCCAACACATGAACTTTGGG + Intergenic
984789189 4:183599219-183599241 GTTTCCAACACATAAATTTTGGG - Intergenic
985073062 4:186187492-186187514 GTTTCCAACACATGAACTTTGGG - Intergenic
986147709 5:5094770-5094792 GTTTCCAGCACATAAACTCTGGG + Intergenic
986927147 5:12769017-12769039 GTTTTAAACACACAAACTTTTGG - Intergenic
986970254 5:13326461-13326483 ATTTCCAACACATAAACTGTAGG - Intergenic
987041904 5:14070756-14070778 GTTTCCAACACATCAACTTTGGG + Intergenic
987178387 5:15340395-15340417 GTTTCCAACACATAAACTTTTGG + Intergenic
987472159 5:18345501-18345523 GTTTTCAACAAATAAACTCTGGG + Intergenic
987648351 5:20706462-20706484 GTTTCCAACACATAAACTTTGGG - Intergenic
987799259 5:22672337-22672359 CTTTCCAGCACACAAACCTCTGG - Intronic
988292224 5:29301802-29301824 GTTTCCAACACATAAATTCTGGG + Intergenic
988747975 5:34162451-34162473 GTTTCCAACACATAAACTTTGGG + Intergenic
988799208 5:34680542-34680564 GTTTCCAGCACATGAACTTCTGG + Intronic
989092356 5:37746478-37746500 GTTTTCAAAACACCAGCTCCTGG - Intronic
989398610 5:40984988-40985010 GTTTCCAACACATGAACTTTGGG + Intergenic
989463481 5:41727617-41727639 GTTTCCAACATACACACTGTGGG + Intergenic
989680555 5:44023544-44023566 GTTTCCAACACATAAATTTGGGG - Intergenic
990180459 5:53155206-53155228 GTTTCCAACACATAAAATCTGGG - Intergenic
991568094 5:68025907-68025929 GTTTCCAACACATAAATTTGGGG + Intergenic
991917338 5:71618184-71618206 ATTTCCAACACATAAACTTTTGG - Intronic
992434464 5:76741974-76741996 GTCTCAAACTCTCAAACTCCTGG - Intergenic
992655205 5:78902286-78902308 GTTTCCAACACATGAACTTTTGG + Intronic
992776040 5:80090145-80090167 GTTTCCAACACATGAACTTCAGG - Intergenic
994563379 5:101407753-101407775 ATTGCCAACAAACAAAGTCCAGG + Intergenic
994885689 5:105558503-105558525 GTTTCTAACACACAAATTTGGGG - Intergenic
995219942 5:109636851-109636873 GTTTTCAAAAAACAAATTCCTGG - Intergenic
995366484 5:111367416-111367438 GTTTCCAACACATGAACTTTTGG + Intronic
995572500 5:113495072-113495094 GTTTCCAACACATGAACTTTGGG + Intergenic
995870660 5:116740418-116740440 TTTTCCACCACCCAGACTCCTGG + Intergenic
996049307 5:118914142-118914164 GTTTCCAACACATGAATTCTAGG - Intronic
996504194 5:124251098-124251120 GTTTCCAACACATAAACTCTGGG - Intergenic
996638808 5:125728632-125728654 GTTTCCAGCACATAAACTTTTGG - Intergenic
997136773 5:131334902-131334924 TTTTCAAAAACACCAACTCCTGG + Intronic
997138021 5:131347203-131347225 TTTTCAAAAACACCAACTCCTGG - Intronic
997231661 5:132249184-132249206 GTTTCCAACACATGAACTCTGGG + Intronic
998265286 5:140663506-140663528 ATTTCAAACCCACAATCTCCAGG - Intergenic
998593746 5:143505768-143505790 GTTTCCAACACATGAACTTTGGG + Intergenic
999535345 5:152510648-152510670 GTTTCCAACACATGAACTTTTGG - Intergenic
999706956 5:154282313-154282335 GTTTCCAACACACAAACTTTGGG + Intronic
1000089307 5:157916511-157916533 GTTTCCAACACATGAACTTTTGG - Intergenic
1000576039 5:162976205-162976227 TTTTCCAACACACAAACTTTTGG - Intergenic
1001361908 5:171094880-171094902 GTTTCAAACACACAAACTTTGGG - Intronic
1001830870 5:174788371-174788393 GTTTCCAACACATAAACTTTGGG + Intergenic
1002676322 5:180916242-180916264 GTTTTCAACACATAAACTCTGGG + Intronic
1002726033 5:181297146-181297168 GTTTCCAGCACATAAACTTTGGG - Intergenic
1002919879 6:1560452-1560474 GTTTCCAACACAGGAACTTTGGG + Intergenic
1003401956 6:5797882-5797904 GTTTCCAACACATGAACTTTGGG - Intergenic
1004228269 6:13807973-13807995 GTTTTCAACACATAAACTTTGGG - Intronic
1004249921 6:14015389-14015411 GTTTCCAACACATAAACTTTGGG + Intergenic
1004414592 6:15413902-15413924 GTTTCCAACACATGAACTTTGGG + Intronic
1004831819 6:19484931-19484953 GTTTTCAAAAAACAAGCTCCTGG - Intergenic
1005229797 6:23686382-23686404 GTTTCCAACACATAAACTTTGGG + Intergenic
1005368656 6:25106648-25106670 ATTTCCAAGATAAAAACTCCGGG - Intergenic
1005545559 6:26865538-26865560 GTTTCCAACACATAAACTTTGGG + Intergenic
1005591887 6:27337240-27337262 TTTTCAAACACAGGAACTCCTGG - Intergenic
1005878480 6:30034541-30034563 GTTTCCAACACATGAACTTTGGG - Intergenic
1006401768 6:33821862-33821884 GTTTCCAACACATGAACTGTGGG - Intergenic
1006791345 6:36703314-36703336 GTTTCCAACACATGAACTTTGGG + Intronic
1007548448 6:42711074-42711096 GTTTCCAACACAGGAACTTTGGG - Intronic
1007923882 6:45635455-45635477 AATGCCAACACACAAACTCCTGG - Intronic
1008188551 6:48425316-48425338 GTTTCCGACACATAAACTTTGGG + Intergenic
1008549159 6:52611091-52611113 GTTTGCAACACAGAAACTTCTGG - Intergenic
1008735978 6:54544459-54544481 ATTGCCAACAAAAAAACTCCAGG - Intergenic
1009016261 6:57906304-57906326 GTTTCCAACACATAAACTTTGGG + Intergenic
1009400633 6:63251250-63251272 GTTTCCAACACATGAACTTTTGG - Intergenic
1009583510 6:65566963-65566985 GTTTCCAACACATGAAATCTGGG - Intronic
1009786694 6:68349559-68349581 GTTTCCAACACATAAACTTTTGG + Intergenic
1010006995 6:71006470-71006492 ATTTCCGACACATTAACTCCAGG + Intergenic
1010514803 6:76760259-76760281 GTTTCCAACACATGAACTTTGGG + Intergenic
1011769775 6:90662819-90662841 GTTTCTAACACATGAACTTCAGG - Intergenic
1012105555 6:95153429-95153451 GTTGCCAACACATGAACTCCTGG - Intergenic
1012290701 6:97452177-97452199 GTTTCCAACACATGAACTTTTGG + Intergenic
1012390797 6:98737328-98737350 GTTTCCAACACACAAATTCTGGG + Intergenic
1013006236 6:106076680-106076702 GTTTCCTACACACAAACAAATGG + Intergenic
1013427615 6:110028084-110028106 GTTGCCAACACACAAATTTTGGG + Intergenic
1013856978 6:114584715-114584737 ATTTCCAACAAAAAAAGTCCAGG + Intergenic
1013981005 6:116129363-116129385 GTTTCCAACACATGAACTTTGGG - Intronic
1014074811 6:117223820-117223842 ATTTCCAACACACAAATTTTGGG - Intergenic
1014883458 6:126750625-126750647 TTTTTCAAAAAACAAACTCCTGG - Intergenic
1015191676 6:130478710-130478732 CTTTTCAACACACCAGCTCCTGG - Intergenic
1015203365 6:130607120-130607142 TTTTCCAACACATAAACTTTGGG - Intergenic
1015550890 6:134411489-134411511 GTTTCCAGCACATAAACTTTCGG + Intergenic
1015810296 6:137155695-137155717 GTTTCCAACACATGAACTTTTGG + Intronic
1016207688 6:141489848-141489870 GTTTTCAACACACAAACTTTGGG + Intergenic
1016227538 6:141758368-141758390 GTTTCCAACACATAAAATTTTGG - Intergenic
1016508792 6:144816193-144816215 TTTTCCAACAGACAAACTGTAGG + Intronic
1016563236 6:145421026-145421048 GTTTCCAACACATGAACTTTTGG + Intergenic
1016949829 6:149568310-149568332 GTTTCCCACAGACACAGTCCAGG - Intronic
1017574362 6:155785930-155785952 GTTTTCAACACATAAACTTTGGG - Intergenic
1017695860 6:157015431-157015453 GTTTCCTCCACCCAAGCTCCAGG - Intronic
1017768331 6:157625148-157625170 GTTTCCAACACACGAACTTCGGG + Intronic
1018175127 6:161171932-161171954 GTTTCCAACACATGAACTCTGGG + Intronic
1018547333 6:164952178-164952200 GTTTCCAACATACAATCTTTAGG - Intergenic
1019830993 7:3330379-3330401 GTTTCCAACACATAAAATTTAGG - Intronic
1021340004 7:19453433-19453455 GTTACCAACAAACAAAGTTCAGG - Intergenic
1022345019 7:29506204-29506226 GTTTCCAACCCCCAAAGTGCTGG - Intronic
1022897866 7:34771026-34771048 GTTTCCAACACACCAATTCTTGG + Intronic
1023029720 7:36081458-36081480 GTTTCCAACACATGAACACTGGG - Intronic
1023397321 7:39763372-39763394 GTTTCCAGCACATAAACTTTGGG - Intergenic
1024070926 7:45784713-45784735 GTTTCCAGCACATAAACTTTGGG - Intergenic
1024363332 7:48492524-48492546 GTTTCCAACACACAGACTTTTGG - Intronic
1024448505 7:49511088-49511110 GTTTCCAATACACAATTTTCTGG + Intergenic
1024710851 7:52012797-52012819 GTTTCCAACACATGAACTTTGGG - Intergenic
1024968947 7:55051280-55051302 GTTTCCAACACATAAGCTTGAGG - Intronic
1025135349 7:56407093-56407115 GTTTCCAGCACATAAACTTTGGG + Intergenic
1025988617 7:66477424-66477446 GTTTCCAGCACATAAACTTTAGG + Intergenic
1026040581 7:66865230-66865252 GTTTCCAGCACATAAACTTTGGG - Intergenic
1026400648 7:70009336-70009358 GTTTCCAACACACAAACTTTGGG + Intronic
1026507214 7:70995204-70995226 GTTTCCAATACATGAACTCTGGG + Intergenic
1027609380 7:80340579-80340601 GTTTTCAACACACAAACTTTGGG - Intergenic
1027777919 7:82489684-82489706 CTTTTCAAAACACCAACTCCTGG + Intergenic
1027886957 7:83920737-83920759 GTTTCCAACACATGAACTTGAGG + Intergenic
1028514477 7:91661067-91661089 GTTTCCAACACATGAACTTTTGG + Intergenic
1029941488 7:104484954-104484976 GTTTCCAACACATGAACTTTGGG + Intronic
1030359783 7:108582762-108582784 GTTTCCAACATACGAACTTTGGG + Intergenic
1030652565 7:112131361-112131383 GATGCCAACACAAAAACTCCAGG + Intronic
1030680346 7:112427307-112427329 GTTTCCAACACATGAACTTTGGG + Intronic
1031879504 7:127180361-127180383 ATTACCAACACAAAAAGTCCGGG + Intronic
1032158520 7:129491211-129491233 GCTTCCAACACACAAACTTTGGG + Intergenic
1032230208 7:130067751-130067773 GTTTCCAACACATGAACTGTGGG + Intergenic
1032922352 7:136563922-136563944 GTTACCAACAAAAAAAGTCCAGG - Intergenic
1033553437 7:142468262-142468284 GTTTCCATCACTCATAGTCCTGG + Intergenic
1034345814 7:150384531-150384553 GTGTCCTACAGACAAAATCCAGG - Intronic
1035425485 7:158769359-158769381 CTTTCTCACACACAGACTCCTGG + Intronic
1035554772 8:558491-558513 GTTTCCAACACAGGAACTTTGGG + Intergenic
1035725256 8:1820812-1820834 GTTTCCAACACATAAACTTTGGG - Intergenic
1036034572 8:5005018-5005040 GGTTCCCACAAACAAACTTCGGG - Intergenic
1036087232 8:5625771-5625793 GTTTTCAACACACAAACTTTGGG - Intergenic
1037215757 8:16449123-16449145 GTTTCCAACACATGAATTCTGGG + Intronic
1037540179 8:19863178-19863200 GTTTTCAACACATAAACTTCGGG - Intergenic
1037972880 8:23186825-23186847 GTTTCCAACACATGAACTTTGGG - Intergenic
1040711100 8:50189623-50189645 GTTAACAACATTCAAACTCCAGG + Intronic
1040824423 8:51605684-51605706 GTTTCCAACACATGAACTTTTGG - Intronic
1040880911 8:52203347-52203369 CTTTCCACCACACAAACTCTTGG + Intronic
1040885793 8:52262285-52262307 CTTTCCAACACATAAACTTTTGG + Intronic
1041959035 8:63590800-63590822 TTTTCAAAGACACAAACTCTTGG + Intergenic
1042197024 8:66239527-66239549 GTTTCCAACACATGAACTTGGGG + Intergenic
1042238244 8:66637120-66637142 GTTTCCAACAAACAAAGGCTAGG + Intronic
1043116332 8:76258464-76258486 GATTCCACCTCACAAAGTCCTGG - Intergenic
1043121385 8:76329558-76329580 ATTTCCAACAAAGAAAGTCCAGG - Intergenic
1043205667 8:77435875-77435897 ATTACCAACAAACAAAGTCCAGG - Intergenic
1043469448 8:80547802-80547824 GTTTCCAACACATGAACTTTGGG + Intergenic
1043654953 8:82651567-82651589 GTTTCCAACACATAAAATTTGGG + Intergenic
1043840902 8:85103169-85103191 TCTTCCAACAAAAAAACTCCAGG - Intergenic
1044554834 8:93551847-93551869 GTTTCCAACACATAAACTTTGGG + Intergenic
1044925712 8:97207054-97207076 GTTTCCAACACATGAACTTTGGG + Intergenic
1045046720 8:98285943-98285965 GTTTCCAACACATGAACTTTGGG - Intronic
1045830918 8:106459136-106459158 GTTTCCAACACATGAACTTTGGG - Intronic
1046377114 8:113398094-113398116 GTTTCCAATATATCAACTCCTGG - Intronic
1046435473 8:114182538-114182560 TTTTCCAACATTCAAACTGCAGG - Intergenic
1046471534 8:114681833-114681855 GTTTGCAACACATAAACTTTGGG + Intergenic
1047006477 8:120625207-120625229 GTTTCCAACACATGAACACTGGG + Intronic
1047568311 8:126070757-126070779 GTTTCCAACACATGAACTTTGGG + Intergenic
1048601896 8:135927459-135927481 GTTTCCAACACATAAACTTTGGG - Intergenic
1049555159 8:143277996-143278018 GTTTCCAACTCAGAAGCCCCCGG + Intergenic
1052041217 9:23741319-23741341 GTTTACAGCAGACAAACTGCAGG + Intronic
1052680834 9:31690378-31690400 ATTTCCAACACATGAACTTCGGG - Intergenic
1052703281 9:31963371-31963393 TTTTTCAAAATACAAACTCCTGG - Intergenic
1052830059 9:33207798-33207820 GTTTCCAACACATAAACTTGGGG + Intergenic
1053027707 9:34744105-34744127 GTTTCCAACACATGAACTTTGGG + Intergenic
1053034362 9:34811290-34811312 GTTTCCAACACATGAACTTTGGG - Intergenic
1053386094 9:37691033-37691055 GTTTTCAACACATGAACTTCAGG + Intronic
1054848570 9:69822320-69822342 GTTTGCAAGACAGAAACTGCAGG - Intronic
1055096614 9:72420887-72420909 CTTTCCAGCACCCAAACCCCTGG - Intergenic
1055126511 9:72724489-72724511 GTTTCCAATACATAAACTTTAGG + Intronic
1055251343 9:74310241-74310263 GTTTCCAACACAGATACTATGGG + Intergenic
1055450102 9:76423223-76423245 GTTTCCAACACATGAACTTTGGG - Intronic
1056290254 9:85135888-85135910 GTTTCCAACACATAAACTTTTGG + Intergenic
1056472875 9:86923217-86923239 GTTTCCAACACATAAACTTTAGG - Intergenic
1056635820 9:88330446-88330468 GTTTCCAACACATAAATTTTGGG + Intergenic
1056831597 9:89921510-89921532 GTTTCAATCACACAAAGCCCAGG + Intergenic
1057640239 9:96812740-96812762 GTTTCCAACATACGAACTTTGGG + Intergenic
1058461255 9:105185648-105185670 TTTTTCAAAAAACAAACTCCTGG + Intergenic
1059454530 9:114391197-114391219 GTTTCAAACACACAAAGACCTGG + Intronic
1059463767 9:114452382-114452404 GTTTCCATCACGCAAATTCAGGG + Intronic
1059820711 9:117969245-117969267 GTTTCCAACACATAAACTTTGGG + Intergenic
1060091019 9:120743549-120743571 GTTTTCAACACACTAGATCCTGG - Intergenic
1061619512 9:131802526-131802548 ATTTCCAACACACTAACCCAGGG + Intergenic
1062751167 9:138254790-138254812 GTTTCCAGCACATAAACTTTGGG - Intergenic
1186734292 X:12444886-12444908 GTTTCCAACACATGAACTTTGGG + Intronic
1186926849 X:14343061-14343083 GTTGCCAACACATAAACTTTGGG + Intergenic
1187081343 X:15992052-15992074 GTTTCCAATACATAAACTTTGGG - Intergenic
1187108968 X:16275907-16275929 GTTACCAACAAAAAAAGTCCAGG - Intergenic
1187549976 X:20292840-20292862 GTTTCCAACACAGGAACTTTGGG - Intergenic
1187971141 X:24659897-24659919 GTTTCTAACACATAAACTTTGGG + Intronic
1188033083 X:25285817-25285839 GTTTCCAACACATGAACTATGGG + Intergenic
1188380391 X:29484444-29484466 GTTTCCAACACATAAAGTTTGGG + Intronic
1188520048 X:31028977-31028999 GTTTCCAACACATGAACTTCGGG - Intergenic
1189973077 X:46437628-46437650 GTTTCCAACACATGAACTTTGGG + Intergenic
1190033674 X:46999337-46999359 GGTTCCAATACACAAACTTTTGG + Intronic
1191047148 X:56150653-56150675 GTTTCCATTACACAACCTCCTGG + Intergenic
1191176912 X:57513855-57513877 CTTTCAAACAAACAAACTCCTGG + Intergenic
1191902603 X:66055180-66055202 GCTTCCAACCCACAGCCTCCCGG + Intergenic
1191908698 X:66124151-66124173 TTTTTCAAAAAACAAACTCCTGG + Intergenic
1192819849 X:74633485-74633507 GTTTCCAACACATGAACTTTGGG - Intergenic
1192839766 X:74842410-74842432 TTTTCCAAGAAACAAACTTCTGG + Intronic
1193338877 X:80322635-80322657 CTTTTCAACACACCAGCTCCTGG - Intergenic
1194151615 X:90331695-90331717 GTTTCCAACACATGAACTTTGGG + Intergenic
1194205649 X:91008402-91008424 GTTTCAAACACATAAACTTTGGG - Intergenic
1194762311 X:97809395-97809417 GTTTCCAACACATGAACTTTGGG + Intergenic
1194816064 X:98443147-98443169 ATTTCCAACAAAAAAAGTCCAGG + Intergenic
1194829316 X:98601250-98601272 GTTTCCAACACATGAACTTTTGG - Intergenic
1195153718 X:102100455-102100477 TTTTTCAACAAACAAGCTCCTGG - Intergenic
1196723600 X:118876899-118876921 GTTTCCAACACATGAACTTTAGG - Intergenic
1196743340 X:119045202-119045224 GTTTCCAACACACGAACTTTAGG + Intergenic
1196801720 X:119549841-119549863 GTTTCCAACACATGAACTTTTGG + Intronic
1196896288 X:120340028-120340050 GTTTCCAACACATAAAATGTGGG - Intergenic
1197629781 X:128845146-128845168 GTTTCCAACAAACAAACTTTGGG - Intergenic
1198078736 X:133218670-133218692 GTTTCCAACACATGAACTTTTGG + Intergenic
1198374283 X:136022467-136022489 GTTTCTAACACACAGTCTCTTGG - Intronic
1198561454 X:137854971-137854993 GTTTCCAACACACAAATTTTGGG + Intergenic
1198678597 X:139157391-139157413 GTTTCCAACACATGAACTTTTGG - Intronic
1198764986 X:140071395-140071417 GTTTCCAACACATAAAATTCAGG + Intergenic
1198979485 X:142379155-142379177 GTTTCCAACACATAAATTTTGGG - Intergenic
1199477849 X:148265467-148265489 GTTTCCAACACATGAATTCTGGG + Intergenic
1199535470 X:148897807-148897829 TTTTCAAACCCACAAACCCCAGG + Intronic
1199936242 X:152576295-152576317 ATTTCCAACACATAAACTTTGGG - Intergenic
1199992617 X:152996241-152996263 GTTTCCAACACATGAACTCTGGG + Intergenic
1200497974 Y:3908442-3908464 GTTTCCAACACATGAACTTTGGG + Intergenic
1200551407 Y:4583213-4583235 GTTTCAAACACATAAACTTTGGG - Intergenic
1200815972 Y:7532712-7532734 GTTTCCAACACACGAATTTATGG + Intergenic
1200833245 Y:7708058-7708080 CTTTTCAAAAAACAAACTCCTGG + Intergenic
1200899199 Y:8410597-8410619 CTTTCCAACAAAAAAAGTCCAGG - Intergenic
1201146863 Y:11069577-11069599 GCTTCCTACACACACACCCCTGG - Intergenic
1201187900 Y:11421644-11421666 ATTTCCAACACATGAACTTCGGG + Intergenic
1201736556 Y:17269307-17269329 GTTTTTAACATACCAACTCCTGG + Intergenic
1202301306 Y:23417963-23417985 GTTTTCAACTCACAAACTCTTGG + Intergenic
1202569505 Y:26252635-26252657 GTTTTCAACTCACAAACTCTTGG - Intergenic