ID: 974874395

View in Genome Browser
Species Human (GRCh38)
Location 4:67685598-67685620
Sequence AGTTTCCAACACACAAACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1169
Summary {0: 1, 1: 8, 2: 69, 3: 303, 4: 788}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974874395_974874402 8 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874402 4:67685629-67685651 GTTACGTAGGACCTAATGGGAGG No data
974874395_974874404 21 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874404 4:67685642-67685664 TAATGGGAGGTGTTGCCTAGTGG 0: 1
1: 0
2: 1
3: 31
4: 245
974874395_974874400 5 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874400 4:67685626-67685648 CCCGTTACGTAGGACCTAATGGG 0: 1
1: 0
2: 0
3: 0
4: 11
974874395_974874396 -5 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874396 4:67685616-67685638 AAACTTAAACCCCGTTACGTAGG No data
974874395_974874406 25 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874406 4:67685646-67685668 GGGAGGTGTTGCCTAGTGGGAGG 0: 1
1: 3
2: 68
3: 535
4: 3266
974874395_974874405 22 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874405 4:67685643-67685665 AATGGGAGGTGTTGCCTAGTGGG 0: 1
1: 0
2: 1
3: 35
4: 417
974874395_974874398 4 Left 974874395 4:67685598-67685620 CCGGAGTTTGTGTGTTGGAAACT 0: 1
1: 8
2: 69
3: 303
4: 788
Right 974874398 4:67685625-67685647 CCCCGTTACGTAGGACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974874395 Original CRISPR AGTTTCCAACACACAAACTC CGG (reversed) Intronic
900017474 1:162667-162689 AGTTTCCAGCACATAAACTTTGG + Intergenic
900047733 1:521263-521285 AGTTTCCAGCACATAAACTTTGG + Intergenic
900069947 1:763127-763149 AGTTTCCAGCACATAAACTTTGG + Intergenic
900821328 1:4891266-4891288 AGCTTCCAACACATGAACTTTGG + Intergenic
901963996 1:12850991-12851013 GGTCTCCAACACCCAACCTCAGG - Intronic
902143445 1:14376276-14376298 AGCTTCCAACACATAAACTTTGG - Intergenic
902415105 1:16233822-16233844 AGTTTCCAACACATGAACTCTGG - Intronic
902541796 1:17160974-17160996 ATTTCCCAGTACACAAACTCAGG - Intergenic
903030453 1:20460316-20460338 AGTTTCCAACACATGAGCTTTGG - Intergenic
903394123 1:22986256-22986278 AGTTTCCAACACACTAATTTTGG - Intergenic
904159524 1:28512657-28512679 TGTTAACAACACACAAATTCTGG + Intronic
904194060 1:28771260-28771282 GGTTTCGAACTCACAACCTCAGG + Intergenic
904315836 1:29662396-29662418 AGTTTCCAACACATGAAATTTGG - Intergenic
904985518 1:34545101-34545123 AGTTTCCAACACATGAAATTTGG - Intergenic
905472143 1:38201297-38201319 AGCTTCCAACACATGAACTTTGG + Intergenic
905555445 1:38878947-38878969 AGTTTCGAACTCCCAACCTCAGG + Intronic
905967299 1:42109577-42109599 AGTTTCCAACACATGAAATTTGG - Intergenic
906308457 1:44736422-44736444 AGTTTCCAGCACATAAAATTTGG + Intergenic
906629908 1:47357905-47357927 AGTTTCCAACACAGGAACTTGGG + Intronic
907083329 1:51644931-51644953 AGTTTCCAACACATGAATGCTGG - Intronic
907622489 1:55995748-55995770 GGTTTCCAACATACAAAATTTGG + Intergenic
908034525 1:60037675-60037697 AGCTTCCAACACATGAACTTTGG + Intronic
908486449 1:64598844-64598866 AGTTTCCAACACATAAATTTGGG - Intronic
908536004 1:65078009-65078031 AGTACCCAACACACAAATTTGGG - Intergenic
909145960 1:71931724-71931746 ATTTTCCAACACATGAACTTTGG + Intronic
909206001 1:72758745-72758767 AGTTTCCAACACATAAAGTTTGG + Intergenic
909407856 1:75312384-75312406 AGTTTCCAACACATGAACCTTGG - Intronic
909408297 1:75317913-75317935 AGGCTCCAACATACAAATTCTGG + Intronic
909418069 1:75430079-75430101 AGTTTCCAACACATAAATGTTGG - Intronic
909455810 1:75847225-75847247 AGTTTCCAACACATGAACGTTGG + Intronic
909513382 1:76479743-76479765 AGTTTCCAACAGATGAACTTTGG + Intronic
909542406 1:76805819-76805841 AGTTTCCAACACATAAACTTTGG - Intergenic
909542691 1:76808192-76808214 AGTTTCTAACACATGAACTTTGG - Intergenic
909638114 1:77840594-77840616 GGTCTCCAACTCCCAAACTCAGG - Intronic
909800159 1:79796784-79796806 AGTTAACCACCCACAAACTCAGG - Intergenic
910015472 1:82518548-82518570 AGTTTCCAACACATGAATTTGGG - Intergenic
910041362 1:82855713-82855735 GGATTTGAACACACAAACTCTGG - Intergenic
910219396 1:84875350-84875372 AGTTTCCAACACATGAACTCTGG - Intronic
910688846 1:89945503-89945525 AGTTTCCAATACATAAACTTTGG + Intergenic
911003676 1:93195515-93195537 AGTTTCCAATACAAAAAATTGGG - Intronic
911555076 1:99333672-99333694 AGCTACCACCACACAAACACGGG - Intergenic
911558274 1:99372728-99372750 AGTTTCCAGCACAAAAATTTTGG - Intergenic
911713118 1:101097869-101097891 AGTTTCCAACACATGAACCTTGG - Intergenic
911761573 1:101623257-101623279 AGTTTCCAACCCATAAACTTTGG - Intergenic
912130995 1:106600253-106600275 AGTTTTCAACACATGAACTTTGG - Intergenic
912180821 1:107217075-107217097 AGTTACCAACAAAAAAAGTCTGG - Intronic
913210346 1:116577222-116577244 AGTTGACAGCACCCAAACTCTGG - Exonic
913441362 1:118901435-118901457 AGTTTGGAACACATAAACTTTGG + Intronic
914045372 1:144087126-144087148 GGTTTCAAACTCACAACCTCAGG - Intergenic
914132738 1:144873560-144873582 GGTTTCAAACTCACAACCTCAGG + Intergenic
914453706 1:147816122-147816144 AGTTTCTAACACATGAACTTTGG + Intergenic
914454010 1:147818566-147818588 AGTTTCCAACACATGAACTTTGG + Intergenic
915110326 1:153560536-153560558 AGTTTCCAACACATGAACTTTGG + Intergenic
915127079 1:153673303-153673325 AGTTTCGAACTCCCAACCTCAGG + Intergenic
915819634 1:159008477-159008499 AGCATACAACACACAAACTGCGG - Intronic
915999089 1:160597305-160597327 CGTTTCCAACATACAAATTTTGG - Intergenic
916279786 1:163036980-163037002 AGTTTCCAACACATGACCTTTGG + Intergenic
916737967 1:167624807-167624829 AGTTCCCAACAAATAAACTTTGG - Intergenic
916904188 1:169263720-169263742 AGAGTCCAACACTCAAATTCAGG + Intronic
917862624 1:179161782-179161804 AGTTTCTAACATACAAACTTTGG - Intronic
918189737 1:182162664-182162686 AGTTTCCAACACCTGAACTTTGG - Intergenic
918327978 1:183428264-183428286 AGTTTCCAACACATGAACTTTGG - Intergenic
918387175 1:184021323-184021345 AGTTTCCAACACATGAACTTTGG - Intronic
918387272 1:184022338-184022360 AGTTTCCAACACATGAACTTTGG - Intronic
918566310 1:185937509-185937531 AGTTTTCAGCACACAAATTCAGG + Intronic
918611559 1:186498162-186498184 AGTTTCCAACACATGAAATTTGG + Intergenic
919109338 1:193198265-193198287 AATTTTCAACACACAAATTTTGG - Intronic
919159492 1:193809474-193809496 AGTTTCCAACACATAAACTTTGG - Intergenic
919398426 1:197080138-197080160 CGTTTCCAACATACGAACTTTGG - Intergenic
919481845 1:198099790-198099812 AATTTCCAACACATGAAATCTGG - Intergenic
919482317 1:198105659-198105681 AGTTTCCAACACATTAACTTTGG - Intergenic
919683472 1:200458886-200458908 AGTTTCCCACATACGAACTTCGG - Intergenic
920041091 1:203097864-203097886 AGTTTCCAACACATGAACTTTGG + Intronic
920050070 1:203159025-203159047 AGTTTCCAACACATGAGCTTTGG + Intronic
920780537 1:208986912-208986934 AGTTTCCAACACATGAACTTTGG - Intergenic
920780547 1:208987056-208987078 AGTTTCCAACACATGAACTTTGG - Intergenic
921072952 1:211677107-211677129 AGTTTCCAACACATGAACTTTGG - Intergenic
921125069 1:212170353-212170375 AGTTTCCAACACATGAAATCTGG - Intergenic
921454382 1:215350242-215350264 AGTTTCCAACACATGAACTTTGG + Intergenic
921585334 1:216939843-216939865 ATTTTCCTACACATACACTCAGG + Intronic
921700909 1:218267482-218267504 AGTTTCCAACACATGAACTTTGG + Intergenic
921719664 1:218456492-218456514 AGTTTTCAACACATGAAATCTGG - Intergenic
921953571 1:220958661-220958683 AGTTTCTAACACATGAACTTTGG - Intergenic
921969118 1:221125852-221125874 TGTTTCCAACACACAAATTTTGG - Intergenic
922015961 1:221647228-221647250 AGTTTTCAACACACGAAATTTGG + Intergenic
922023435 1:221727902-221727924 AGTTTCCAATACATGAACTTTGG - Intronic
922036324 1:221852025-221852047 AGTCTCCAACCCACAATCACTGG + Intergenic
922105319 1:222508584-222508606 AGTTTCCAGCACATAAACTTTGG + Intergenic
922122539 1:222686866-222686888 AGTTTCAAACACCCTGACTCTGG + Intronic
922217091 1:223528655-223528677 AGTTTCCAACACATGAATTTGGG + Intergenic
922265653 1:223981163-223981185 AGTTTCCAGCACATAAACTTTGG + Intergenic
922577740 1:226674039-226674061 AGTTGCCACCCCACTAACTCCGG + Intronic
922995197 1:229951813-229951835 AGTTTCCAACATATGAAATCTGG - Intergenic
923336424 1:232974889-232974911 AGTTTCCAACACATGAAATGTGG + Intronic
923501283 1:234567043-234567065 AGTTTCCAACACATAAACTTTGG - Intergenic
923750398 1:236741527-236741549 AGTTGCCAACCCCCAAACCCAGG + Intronic
923755054 1:236784698-236784720 AGTTTCCAACACACGAACTTTGG + Intergenic
923838525 1:237642045-237642067 TGTTTCAAACTCTCAAACTCTGG - Intronic
923880543 1:238099400-238099422 AGTTTCCAACACATGAATTTTGG + Intergenic
923880618 1:238100277-238100299 AGTTTCCAACATATAAACTTTGG + Intergenic
923949813 1:238936404-238936426 AGTTTACAACACATGAACTTTGG + Intergenic
924347491 1:243086115-243086137 AGTTTCCAGCACATAAACTTTGG + Intergenic
924542420 1:244993915-244993937 AGTTTCCAACACACGAACTTTGG + Intronic
924597398 1:245459395-245459417 AGATTCCAAAAAACAAAATCGGG - Intronic
1062868221 10:875804-875826 ATTTTCCAACACATGAACTTTGG + Intronic
1063323733 10:5076229-5076251 AGTTTCCAACACATGGACTTTGG - Intronic
1063345937 10:5312478-5312500 AGTTTCCAACACATGAAATCTGG + Intergenic
1063434010 10:6016066-6016088 AGTTTCCAACACCTGAGCTCTGG - Intronic
1063473472 10:6307784-6307806 AGTTTCCAACACATGAACTTTGG - Intergenic
1064326962 10:14360277-14360299 AGCTTCCAACACATAAACTTTGG + Intronic
1064499578 10:15955311-15955333 AGTTTCCAACACATGAAATTTGG + Intergenic
1064787363 10:18913113-18913135 AGTTTCCAACACATACAATTTGG - Intergenic
1065304619 10:24356531-24356553 AGTTTCTAACACATGAACTTTGG - Intronic
1065393735 10:25211626-25211648 AGTTCCTAACACACGAACTCTGG + Intronic
1065541092 10:26768327-26768349 GGTTTCCAACTCCCAACCTCAGG - Intronic
1065705946 10:28471730-28471752 AGTTTCCACCCCACCAGCTCAGG + Intergenic
1065710721 10:28514932-28514954 ATTTTCCAACACAAGAACTTTGG - Intergenic
1065743008 10:28813999-28814021 AATTTCCAACACATGAACTTTGG + Intergenic
1065835080 10:29649785-29649807 AGTTCCCAGCACATGAACTCTGG - Intronic
1065906828 10:30262407-30262429 AGTTTCCAACACATGGACTTCGG + Intergenic
1065978604 10:30867077-30867099 AGTTTCCATCTGACAAACTTTGG + Intronic
1066537862 10:36411017-36411039 AGTTTCCAACACAGAAACGTTGG - Intergenic
1066629708 10:37447121-37447143 AGTTTCCAACACATAAACTTTGG - Intergenic
1066673397 10:37863022-37863044 AGTTTCCAACACATGAGCTTTGG - Intergenic
1066728862 10:38418755-38418777 AGTTTCCAGCACATAAACTTTGG - Intergenic
1066757086 10:38722101-38722123 AATTTCCAACACATGAACTTTGG + Intergenic
1067282944 10:44886706-44886728 AGTTTCCAACACATGAATTTTGG - Intergenic
1067358068 10:45549612-45549634 AGTTTCCAATACATGAACTTGGG - Intronic
1067509717 10:46884856-46884878 AATTTCACACACACAAATTCAGG + Intergenic
1067652537 10:48167002-48167024 AATTTCACACACACAAATTCAGG - Intronic
1067739757 10:48886363-48886385 AGTTTCCAACACAAGAATTTTGG - Intronic
1067913535 10:50371985-50372007 AGTTTCCAACACGTGAACTCTGG + Intronic
1068065276 10:52122360-52122382 AGTTTCCAAGACATAAATTCTGG + Intronic
1068248852 10:54409679-54409701 AGTTTCCAATACACAAAATTTGG - Intronic
1068484258 10:57636327-57636349 AGTTTCCAACACATGGACTTTGG + Intergenic
1068558268 10:58482345-58482367 AGTTTTCAACACATAAACTTTGG - Intergenic
1069155864 10:65030257-65030279 TGTTTCCAACACATAAACTTTGG - Intergenic
1069196486 10:65557038-65557060 AGTTTCTAACACATGAACTTTGG - Intergenic
1069297463 10:66864157-66864179 AGTTTCCAACACATGATCTTTGG - Intronic
1069344398 10:67450963-67450985 AGTTTCTAACACATGAACTTTGG - Intronic
1069632848 10:69907942-69907964 AGTTTCCAACACAAGAGCTATGG + Intronic
1070336501 10:75459968-75459990 AGTTTCCAATACATGAACTTTGG + Intronic
1071013203 10:80963590-80963612 AATTTCTAACACATAAACTTTGG + Intergenic
1071036237 10:81249424-81249446 AGTTTCCAACACACGAACTTTGG - Intergenic
1071036678 10:81255847-81255869 AGTTTCCAACACATGAATTTAGG + Intergenic
1071359681 10:84833672-84833694 AGCTTCCAACACATGAACTTTGG - Intergenic
1071822739 10:89294596-89294618 AGTTTCCAACACATGAACTTTGG + Intronic
1071967916 10:90871808-90871830 TGATTTCAACACACAAATTCTGG + Intronic
1072202295 10:93171427-93171449 AATTTCCAACACATAAACTTTGG + Intergenic
1072868774 10:99093758-99093780 AGTTTCCAACACATGAATTTTGG + Intronic
1073517682 10:104092068-104092090 AGTTTCCAACACATGAACTTTGG - Intergenic
1074098932 10:110338144-110338166 AGTTTCCAACACATGAACTTTGG - Intergenic
1074590762 10:114810685-114810707 AGTTTGCAACACATGAACTTTGG + Intergenic
1075145223 10:119876971-119876993 AGTTTCCAACACCCAAACTCTGG - Intronic
1075291029 10:121231015-121231037 AGTTTCCAACCCATGAACTTTGG + Intergenic
1075350988 10:121725145-121725167 AGTTTCCAACACATGAATTTTGG + Intergenic
1075586680 10:123663600-123663622 GGTTTCCAACACATGAACTTTGG + Intergenic
1075620086 10:123920668-123920690 AGTTTCCAACACGTGAACTATGG - Intronic
1075970487 10:126647994-126648016 AGTTTCCAACACATGAATTTTGG - Intronic
1075984368 10:126770877-126770899 AGTTTCCAACACATGTACTTTGG - Intergenic
1075990346 10:126833071-126833093 ATTTTCCAACACATGAACTTTGG - Intergenic
1076056036 10:127373622-127373644 AGTTGCCAACACAGAACCCCTGG - Intronic
1076221654 10:128738661-128738683 AGTTATTAACACACAAACTCAGG + Intergenic
1076251585 10:128988258-128988280 AGTTCCCAACACACAAACTTTGG + Intergenic
1076974071 11:157873-157895 AGTTTCCAGCACATAAACTTTGG + Intergenic
1077804471 11:5576397-5576419 AGTTTCCAACCAAGGAACTCAGG + Intronic
1078414283 11:11152664-11152686 AGTTTCCAACACATGAACTCTGG + Intergenic
1078433916 11:11309006-11309028 AGTTTTCAACACATGAACTTTGG - Intronic
1078468906 11:11571321-11571343 TGTTTCCACCACACAAAGTCAGG - Intronic
1078606323 11:12779295-12779317 AGTTTCCAGGATACAAAATCTGG + Intronic
1078657098 11:13251719-13251741 AGTTTCCAACACACAAACTTTGG + Intergenic
1078732164 11:13984654-13984676 AGTTTCCAACACATAAACTTTGG + Intronic
1078756625 11:14216798-14216820 AGTTTCCAACACATGAATTTTGG + Intronic
1078816225 11:14824749-14824771 AGAGGCCAACACCCAAACTCAGG + Intronic
1079142587 11:17822467-17822489 AGTTACCCACACAGAAATTCTGG + Intronic
1079551254 11:21701279-21701301 AGTTTCCAACACATTAATTTTGG - Intergenic
1079967151 11:26993875-26993897 AATTTCCACCACAAAAACCCTGG - Intergenic
1079982212 11:27163183-27163205 AGTTTCCAACACATGAATTTTGG - Intergenic
1080053382 11:27880109-27880131 AGTTTCCAACACATGAACTTTGG - Intergenic
1080414122 11:32053692-32053714 AGTTTCCAACACATAAATCTTGG - Intronic
1080512963 11:32993422-32993444 AGTTTCCAACACATACATTTTGG + Intergenic
1081394501 11:42569631-42569653 AGTTTCCAACACATGAATTTTGG + Intergenic
1081752575 11:45522417-45522439 AGTTTCCAACACGTTAACTTTGG - Intergenic
1082931624 11:58613429-58613451 AGTTTCCAACACATGAACTGTGG + Intronic
1083558244 11:63649752-63649774 GGTCTCGAACACCCAAACTCAGG + Intronic
1084616928 11:70242642-70242664 AGTTTCCAACACATGAACTTTGG + Intergenic
1085064515 11:73481790-73481812 AGTTTCCAACACATAAATTTTGG - Intronic
1085262715 11:75217192-75217214 AGTTTCTAACACATGAACTTTGG - Intergenic
1085467401 11:76733628-76733650 AATTTCCAACATACAGACTTTGG + Intergenic
1085956599 11:81405351-81405373 AGTTTCCAACACGCTAACTTTGG - Intergenic
1086488417 11:87333607-87333629 AGTTTCCAACACATGAACTTTGG - Intergenic
1086615937 11:88820043-88820065 AGTTTCCCACACATGAACTTTGG + Intronic
1086670946 11:89546906-89546928 TGTTTCCAACACACAAACTTTGG + Intergenic
1086935582 11:92742493-92742515 TGTTTCCAACACATAAACTTTGG - Intronic
1086962493 11:92993337-92993359 AGTTTTCTACACACACAATCAGG - Intergenic
1087564353 11:99835366-99835388 AGTTTACACCACACAAACCCTGG - Intronic
1087604042 11:100353219-100353241 AGTTTCCCATACTGAAACTCAGG - Intronic
1087775523 11:102253310-102253332 AGTTTCCAACACGTGAACTCTGG + Intergenic
1088181516 11:107118040-107118062 AGTTTCCAACACATGAACTGTGG - Intergenic
1088343534 11:108796715-108796737 AGTTTCCAACACAATAACTTTGG - Intronic
1088566424 11:111177682-111177704 AGTTTCCAACACATGAAATCTGG + Intergenic
1088709408 11:112493761-112493783 AGTTTCCAACACAGGAACTTTGG + Intergenic
1088759555 11:112916233-112916255 AGTTTCCAACACATAAACTTTGG + Intergenic
1088915627 11:114225691-114225713 AGTTTTCAACACAGGAACTTTGG + Intronic
1089107239 11:116023217-116023239 TGTTTCCAACACATGAACTTTGG - Intergenic
1089112010 11:116064730-116064752 AGTTTCCCCCACACACAATCAGG + Intergenic
1089605031 11:119636735-119636757 ACTTTCCAACACACGAATTTGGG - Intronic
1090065399 11:123499090-123499112 AGTTTCCAACACATAAATTTTGG - Intergenic
1090148393 11:124354187-124354209 AGTTTCCAACACATAAAATTTGG - Intergenic
1090903742 11:131055529-131055551 GGTTTCCAACACATAAATTTTGG + Intergenic
1091159004 11:133402382-133402404 AGTTTCCAAAACATAAACTTTGG + Intronic
1091905877 12:4188869-4188891 AGCTTCCTACACCCAACCTCAGG - Intergenic
1093009768 12:14094168-14094190 AGTTTCCAGCATATAAACTTTGG + Intergenic
1093037819 12:14350010-14350032 AGTTTCCAACACATGAAGTTTGG - Intergenic
1093538822 12:20255984-20256006 AGTTTCCAACACATAAACTTTGG + Intergenic
1093636432 12:21475878-21475900 GGTTTTCAACACACACATTCAGG + Intronic
1094060226 12:26306748-26306770 AGTTTCTAACACATGAACTTTGG + Intergenic
1094305613 12:29016199-29016221 AGTTTCCAACACATTAACAGTGG + Intergenic
1094395760 12:30003637-30003659 AGTTTCCTACACATAAACTTTGG - Intergenic
1094628622 12:32150278-32150300 AGGTTCCAACATACAAATTTTGG + Intronic
1095136107 12:38605934-38605956 AGTTTCCAACACATGAACTTTGG + Intergenic
1095136577 12:38612208-38612230 TGTCTCAAACTCACAAACTCAGG - Intergenic
1095326150 12:40895671-40895693 TGTTTCCAACACATGAAATCTGG + Intronic
1095529831 12:43173936-43173958 AGTTACCAACACATGAACTTTGG - Intergenic
1096174208 12:49501494-49501516 AGTTTCCAACACACGAGCTTTGG + Intronic
1097443263 12:59637717-59637739 ACTTTCCAACACATGAACTTTGG - Intronic
1097515440 12:60599039-60599061 AGATTTCAACACATAAACTTTGG - Intergenic
1097687486 12:62704408-62704430 ATCTTCCAACACATAAATTCAGG - Intronic
1097721248 12:63023902-63023924 GGTTTCCAACACATGAACTGCGG - Intergenic
1097863319 12:64539395-64539417 AGTTTCCAACACATGAAATTTGG + Intergenic
1098010500 12:66045741-66045763 GGATTCAAACACACAAAGTCTGG + Intergenic
1098115452 12:67171729-67171751 AGTTTCCAACACATGAACCTCGG - Intergenic
1098536239 12:71596517-71596539 AATTTCCAAAACATAAACTTTGG - Intergenic
1098947218 12:76602173-76602195 AGTTTCCAACACATGAACTTTGG + Intergenic
1099012836 12:77312422-77312444 AGTTTCTAACACATAAACTTTGG + Intergenic
1099810864 12:87580487-87580509 AGTTTCCAACACATGAACTTTGG + Intergenic
1099873342 12:88374965-88374987 AGTTTCCAACACGTGAACTTTGG + Intergenic
1100052596 12:90467779-90467801 AGTTTCTAACACATGAACTTTGG + Intergenic
1100957249 12:99922685-99922707 AGTTCCCAACACATGAACTTCGG - Intronic
1101103319 12:101416797-101416819 TGTTTCCAACACATGAACTTTGG - Intergenic
1101252253 12:102948031-102948053 AGATTCCCACAGACACACTCTGG + Intronic
1101368109 12:104095445-104095467 TGTTTCCAGCACACAAACTATGG + Exonic
1101540511 12:105660698-105660720 AGTTTCCAACACATGAAATTTGG + Intergenic
1101646852 12:106638920-106638942 AGGTTTCAACACACAAATTTTGG + Intronic
1102431554 12:112888064-112888086 AGATTCCAGCTCACAACCTCAGG + Intronic
1102437413 12:112936123-112936145 AGTTTCCAACACATGAATTCTGG + Intergenic
1102844214 12:116161225-116161247 AGTTTCTAACACACAAACTTTGG + Intronic
1103227243 12:119298547-119298569 AGTTTCTAACACATGAACTTTGG - Intergenic
1104118540 12:125774434-125774456 AGTTTCTAACACATAATCTTTGG - Intergenic
1104157328 12:126146297-126146319 ACTTTCCAACACATAAACTTTGG + Intergenic
1104486721 12:129157317-129157339 AGTCTCCGACTCATAAACTCTGG + Intronic
1105530050 13:21211005-21211027 AGTTTCCAACACATGACCTTTGG + Intergenic
1105607162 13:21935558-21935580 AGTTTCAAACACATGAACTTTGG - Intergenic
1105624104 13:22096546-22096568 AGATTCCACCACACACACTGAGG - Intergenic
1105704678 13:22961634-22961656 AGATTTCAACACAGAAATTCTGG - Intergenic
1105933466 13:25074941-25074963 AGTTTCCAACGCATGAACTGTGG + Intergenic
1106116241 13:26820386-26820408 AGTTTCCAACATATAAAGTTTGG + Intergenic
1106652693 13:31708666-31708688 AGTTTTCAACACACAAAATCTGG + Intergenic
1106738462 13:32612575-32612597 AGTTCCCAACACATGAACTTTGG - Intronic
1106872967 13:34041925-34041947 AGTTTCCAACACATGAAATTTGG - Intergenic
1107019303 13:35735297-35735319 AATTTCCAACACATAAACTTTGG + Intergenic
1107270592 13:38611191-38611213 AGTTTCCAACACCTGAACTTTGG + Intergenic
1107344357 13:39443020-39443042 AGTTTGCAACACATGAACTTTGG - Intronic
1107582449 13:41805595-41805617 AGTTTCAAACTCCCAACCTCAGG - Intronic
1107610218 13:42105425-42105447 AGTTTTCAACACATGAACTGTGG + Intronic
1107832782 13:44389257-44389279 GGTTTCAAATACACAAAGTCTGG - Intronic
1107877611 13:44804579-44804601 AGTTTTCAATACACAAATTTTGG + Intergenic
1107980111 13:45727205-45727227 AGGTTCCAACATACAAATTTGGG + Intergenic
1108005605 13:45942879-45942901 AGTTTCCAACACATGAACTTTGG - Intergenic
1108161438 13:47644563-47644585 AGTTTCCAACACATACATTCTGG - Intergenic
1108224998 13:48280156-48280178 TGATTCAAACATACAAACTCAGG - Intergenic
1108386631 13:49905073-49905095 AGTTTCCAGCACATGAACTGTGG - Intergenic
1108582035 13:51836059-51836081 AGTTTCCAACACATGAACTTTGG - Intergenic
1108792449 13:53987806-53987828 AGCCCCCAACACACAAAATCTGG + Intergenic
1109199852 13:59418213-59418235 AGTTTCCACCTCTCAAACTTTGG - Intergenic
1109348978 13:61152463-61152485 AGTTTTCAACACATAAACCTTGG - Intergenic
1109720737 13:66273148-66273170 AGTTTCCAACCCATAAACTTTGG - Intergenic
1109869541 13:68315562-68315584 AGTTTCCAATACATGAACTTTGG + Intergenic
1110076833 13:71256437-71256459 AGTTTCCAACACATGAATTTTGG + Intergenic
1110439936 13:75516656-75516678 AGTTTCCAACACATGAACTTTGG - Intergenic
1110674141 13:78219896-78219918 AGTTTCCAACACGTGAACTTTGG - Intergenic
1110759933 13:79220287-79220309 AATTTCCAACACATGAATTCAGG + Intergenic
1110994171 13:82084330-82084352 AGTTTCCAACAAATGAACTTTGG + Intergenic
1111044120 13:82792834-82792856 AGATATCAACACACAAACACTGG - Intergenic
1111044628 13:82798219-82798241 ATTTTCTAACACATAAACTTTGG - Intergenic
1111074651 13:83217800-83217822 AGTTCCCAATGCACAAACTTTGG - Intergenic
1111248072 13:85568270-85568292 AGTTTCCAACACATGAAATTTGG + Intergenic
1111773967 13:92635629-92635651 AGTTTCTAACACATGAACTTTGG + Intronic
1112159783 13:96855218-96855240 AGTTTTCAGCTCACAAACACAGG + Intergenic
1113971385 13:114193642-114193664 AGTTTCCAACACATAAATTTTGG + Intergenic
1114653589 14:24302416-24302438 GGTTTCCAACTCACCAGCTCAGG - Exonic
1114795439 14:25710269-25710291 CGTTTCCAATACATAAACTTTGG + Intergenic
1114857478 14:26466661-26466683 AGTTTCCAACACATGAATTTTGG - Intronic
1114877346 14:26737019-26737041 AGTTTCCATCATTCAAAATCAGG + Intergenic
1115012403 14:28565219-28565241 AGTTCCCAACACATGAACTATGG - Intergenic
1115121204 14:29940441-29940463 AGTTTCCAACACATGAAATTTGG + Intronic
1115326989 14:32150735-32150757 AGTTTCCCACACAAGAACTTTGG + Intronic
1115656023 14:35444519-35444541 AGTTTCCAACACATAAAATTTGG + Intergenic
1116054992 14:39852606-39852628 AATTTCCAACACATGAACTTTGG + Intergenic
1116125446 14:40778409-40778431 CGTTTCCACCCCACTAACTCTGG - Intergenic
1116439995 14:44940289-44940311 AGTTTCCAACACATGAATTTTGG + Intronic
1116729227 14:48601264-48601286 AGTTTTCAACACATGAACTTTGG - Intergenic
1117202495 14:53406614-53406636 AGTTTCCAACACATGAACTTTGG - Intergenic
1117266874 14:54098198-54098220 TGTTTCCAACACATAAATTTGGG + Intergenic
1117305813 14:54472058-54472080 AGTTTCCAACACATGAATTTTGG - Intergenic
1117391696 14:55268677-55268699 AGTTTCTAACACATAAACTTTGG + Intergenic
1117435501 14:55712082-55712104 AGTTTCCAACACATGAACTTCGG - Intergenic
1117668256 14:58079538-58079560 AGCTTCCAACACATAAATTTCGG + Intronic
1117833280 14:59776197-59776219 AGTTTCCAACACATGAACTTTGG - Intronic
1118067591 14:62208505-62208527 AGTTTCTAACATATAAACTTTGG + Intergenic
1118340279 14:64890044-64890066 AGTCTCCAACACATGAACTTTGG + Intergenic
1118825335 14:69375036-69375058 AGTTTCCAACACATAAACTTTGG + Intergenic
1119128145 14:72147591-72147613 GGTTTCCAGCACATAAACTTTGG + Intronic
1119529099 14:75347053-75347075 AGTTTCCAACACATGAGCTTTGG - Intergenic
1119533173 14:75377847-75377869 AGTTTCCAACACATAAACTCTGG - Intergenic
1119550252 14:75504794-75504816 AGTTTCCAAAACATGAATTCTGG + Intergenic
1119630328 14:76226545-76226567 AGTTTCCAACACACACATTTTGG - Intronic
1119835185 14:77743007-77743029 AGTCTCCAACTCCCAACCTCAGG - Intronic
1119990941 14:79196549-79196571 ACTTTCCAACACATGCACTCTGG + Intronic
1120257520 14:82139608-82139630 AATTTCTAACACACAAAATTTGG + Intergenic
1120314722 14:82876440-82876462 AGTTTTCAACACATGAACTTTGG - Intergenic
1120497718 14:85257392-85257414 AGTCTGCAACCCACCAACTCTGG + Intergenic
1120508986 14:85389668-85389690 AGTTTCCAACACCTGAACTTTGG + Intergenic
1120792279 14:88596243-88596265 AGTTCCTAAAAGACAAACTCTGG - Intronic
1120932367 14:89861603-89861625 AGTTTCCAACACATGAAATTTGG - Intronic
1120982016 14:90298639-90298661 TGATTCCAACACACAAAATATGG + Intronic
1121421094 14:93815021-93815043 AGTTTCCAAGACATGAACTTTGG + Intergenic
1121703181 14:95971786-95971808 AGTTTCCAACACATAAAATCTGG - Intergenic
1122001724 14:98662758-98662780 AGTTTCCAACACATGAACTTTGG + Intergenic
1122285517 14:100649596-100649618 AGTTCCCAAGACACAAACTTTGG - Intergenic
1202935014 14_KI270725v1_random:79881-79903 AGTCTCAAACTCCCAAACTCAGG + Intergenic
1124347644 15:28933206-28933228 GGTTTCCAACACATGAACTTTGG + Intronic
1124418688 15:29496962-29496984 AGTTTCTAACACATTAACTTTGG - Intronic
1124508873 15:30305391-30305413 AGTTTCCAACACATGAACTTTGG + Intergenic
1124591363 15:31056584-31056606 AGTTTCCAACACAAGAACTTTGG - Intronic
1124734685 15:32233271-32233293 AGTTTCCAACACATGAACTTTGG - Intergenic
1124936722 15:34179446-34179468 AGTTTCCAACACGTGAACTCTGG + Intronic
1125255046 15:37753575-37753597 AGTTTCCAACACATGAACTTTGG + Intergenic
1125753651 15:42047551-42047573 AGTTTCCAACACATGACCTTTGG + Intronic
1125753898 15:42049441-42049463 AGTTTCCAACACATGAATGCTGG + Intronic
1126176925 15:45744562-45744584 ATTTTCTAACACATAAACTTTGG - Intergenic
1126283188 15:46980414-46980436 ACTTTCCAACACAAGAACTTTGG - Intergenic
1126423544 15:48501166-48501188 AGTTTCCAGCACATGAACTTTGG - Intronic
1126656331 15:50981657-50981679 TGTTTCCAACACATGAACTTTGG - Intronic
1127143539 15:56001816-56001838 AATTTCCAACACATAAACTTTGG - Intergenic
1127519892 15:59733457-59733479 AGTTGCCAACACGTAAACTGTGG - Intergenic
1128303765 15:66584257-66584279 AGTTTCCAACACACAAACTTTGG - Intronic
1128564083 15:68687960-68687982 AGTTTCCAACACATGAACTCTGG + Intronic
1128751253 15:70151535-70151557 AGTTTTCAACACACAAACTTTGG - Intergenic
1129746605 15:78026200-78026222 AATTTCTAACACATAAACTTTGG - Intronic
1129786007 15:78310606-78310628 AGTTTCCAACACACGAACTTTGG + Intergenic
1130017054 15:80195749-80195771 AGTTTCCAACATATGAACTTTGG + Intergenic
1131518865 15:93098542-93098564 AGTTTCCAACACATGAACTTTGG + Intergenic
1131662916 15:94537901-94537923 AGTTTCCACCACATGAACTTTGG - Intergenic
1131724785 15:95209354-95209376 AGTTTCCAACACAAGAATTTTGG + Intergenic
1131769626 15:95721830-95721852 AGATTCCAACACATGAACTTTGG + Intergenic
1131861998 15:96663659-96663681 AGTTTCCAACACATGAACTTTGG - Intergenic
1131919400 15:97307349-97307371 ATTTTCCAACCCCCAACCTCTGG + Intergenic
1132290796 15:100702142-100702164 ATTTTCAAACCCTCAAACTCTGG - Intergenic
1132736842 16:1390420-1390442 CGTTTCAAACAGACAAACACGGG + Intronic
1133003488 16:2863855-2863877 AGTTTCCAACACATGAACTTTGG - Intergenic
1133852185 16:9515954-9515976 AGTTTCCAACACATGAACTTTGG + Intergenic
1134038518 16:11050306-11050328 AGTTTCCAACACATGAACTATGG + Intronic
1134334065 16:13278545-13278567 AATTACCAACAAAAAAACTCCGG - Intergenic
1134571895 16:15298217-15298239 AGTTTCCAGCACTCGAACTTTGG - Intergenic
1134768951 16:16787917-16787939 AGCTTTCAACACATGAACTCTGG - Intergenic
1134899919 16:17928176-17928198 AGATTCCAACATATAAACTCTGG + Intergenic
1135066682 16:19316025-19316047 AGTTTCAAACACAAAACCTGGGG - Intronic
1135072910 16:19368045-19368067 AGTTGCCAACACATGAACTTTGG + Intergenic
1135159998 16:20085729-20085751 AGTCTCCAACTCCCAACCTCAGG - Intergenic
1135160590 16:20091896-20091918 AGTTTTCAACACATAAACTTTGG + Intergenic
1135254366 16:20929033-20929055 ATTTTCTAACACATAAACTTTGG + Intergenic
1135606419 16:23828941-23828963 ACTTTCCAACACATGAAATCTGG + Intergenic
1135650316 16:24200831-24200853 AGTTTCTAACACATGAACTTTGG + Intronic
1135677146 16:24425479-24425501 GGTCTCCAACTCCCAAACTCAGG + Intergenic
1135754295 16:25083652-25083674 AGTTTCCAACACATGAACTTTGG - Intergenic
1136612458 16:31374826-31374848 AGTGTCCAACACACGAACATTGG - Intronic
1136627257 16:31469388-31469410 AGTTTCCAACACATGAACTCTGG - Intergenic
1136720435 16:32315632-32315654 AATTTCCAACACATGAACTTTGG - Intergenic
1136725490 16:32354023-32354045 AATTTCCAACACATGAACTTTGG - Intergenic
1136838812 16:33521906-33521928 AATTTCCAACACATGAACTTTGG - Intergenic
1136843819 16:33560079-33560101 AATTTCCAACACATGAACTTTGG - Intergenic
1137431741 16:48423725-48423747 GGTCTCAAACTCACAAACTCAGG + Intronic
1137591175 16:49694840-49694862 CATTTCCAACACACAAAATAGGG + Intronic
1137934964 16:52626002-52626024 AATTTCCAACACATAAACTTCGG - Intergenic
1137989854 16:53143152-53143174 AGTTTCCAACACCTAAACTTTGG + Intronic
1138035563 16:53602557-53602579 AGTTTCAAACTCTCAACCTCAGG - Intronic
1138208558 16:55143584-55143606 AGTATCCAGCACATGAACTCTGG - Intergenic
1138976622 16:62215150-62215172 AGTCTCCAACACATAAACAATGG - Intergenic
1140391717 16:74592850-74592872 AGTTTCCAACACATGAACTTTGG - Intronic
1140554622 16:75907732-75907754 AGTCTCCAACACGCGAACTTTGG - Intergenic
1140584119 16:76268407-76268429 AGTTTCCAACATACGAACTTTGG - Intergenic
1140584366 16:76271945-76271967 AGTTTCCAATCCACAAACACTGG - Intergenic
1141970955 16:87482118-87482140 AGTTTCTAAGACGCAAACTTTGG + Intronic
1142446187 16:90139790-90139812 AGTTTCCAGCACATAAACTTTGG - Intergenic
1203000942 16_KI270728v1_random:163733-163755 AATTTCCAACACATGAACTTTGG + Intergenic
1203005997 16_KI270728v1_random:202137-202159 AATTTCCAACACATGAACTTTGG + Intergenic
1203132543 16_KI270728v1_random:1700136-1700158 AATTTCCAACACATGAACTTTGG + Intergenic
1203148977 16_KI270728v1_random:1822194-1822216 AATTTCCAACACATGAACTTTGG - Intergenic
1203153984 16_KI270728v1_random:1860377-1860399 AATTTCCAACACATGAACTTTGG - Intergenic
1142461318 17:95673-95695 AGTTTCCAGCACATAAACTTTGG + Intergenic
1142541747 17:665041-665063 TGTTTCCAACACATGAACTTTGG - Intronic
1143053797 17:4147635-4147657 GGTTTCGAACTCCCAAACTCAGG - Intronic
1143138661 17:4727461-4727483 GGTTTCCAACTCCCAACCTCAGG + Intergenic
1143271361 17:5677722-5677744 AATTTTCAACACACGAACTTTGG + Intergenic
1143274816 17:5702605-5702627 AGTTTTCAACACATGAAATCTGG - Intergenic
1143316922 17:6039880-6039902 AGTTTCCAACACATAGATTTTGG + Intronic
1143942998 17:10562363-10562385 AGTTTCCAATACATGAACTTTGG - Intergenic
1144124461 17:12189714-12189736 AGTTTCTAACACATAAATTTTGG + Intergenic
1144183706 17:12776011-12776033 GGATTCCAATTCACAAACTCAGG - Intergenic
1144244021 17:13345506-13345528 AGTTTCCAACACATTAATTTTGG + Intergenic
1144244034 17:13345599-13345621 AGTTTCCAACACATGAATTTTGG + Intergenic
1144939413 17:18927284-18927306 AGTTTCCAACACATGAATTTTGG + Intronic
1145030068 17:19498184-19498206 AGTTTCCAACACATGAAATTTGG - Intronic
1145727425 17:27144028-27144050 AGTTTCCAACACATGAAATTTGG - Intergenic
1146380909 17:32326724-32326746 AGTTTCGAACACCCGACCTCAGG - Intronic
1146529981 17:33600196-33600218 CGTTTCCAACACATCAACTTTGG - Intronic
1146530228 17:33602262-33602284 AGTTTCCAGCACAGGAACTTTGG - Intronic
1146672639 17:34752342-34752364 AGTTTCTAACACATGAACTTTGG + Intergenic
1146730148 17:35186228-35186250 CATTTCCAACACATGAACTCTGG + Intronic
1146985848 17:37217044-37217066 TGTCTCCAACACCCTAACTCAGG - Intronic
1147774694 17:42892358-42892380 AGTCTCGAACTCCCAAACTCAGG - Intergenic
1147985597 17:44305877-44305899 AGTTTCCAACACATGAACTTCGG + Intergenic
1148405502 17:47410410-47410432 AGTTTTCAGCACATAAACTTTGG + Intronic
1148934930 17:51157525-51157547 AATTTCCAACATACGAACTTTGG + Intronic
1149800475 17:59563056-59563078 AGTTTCTAACACAAAAATTAGGG + Intergenic
1150686875 17:67327966-67327988 AGTTTCCAACACATGAACTTTGG - Intergenic
1150967200 17:69984808-69984830 AGTTTCCAATACAAAAACTTTGG + Intergenic
1151191771 17:72403928-72403950 TGCTTGCAACACACAAACACTGG + Intergenic
1151435733 17:74095931-74095953 AGATTCAAACACATAAACTTTGG - Intergenic
1151631241 17:75312560-75312582 AGTTTCAAACTCCCAACCTCAGG + Intergenic
1151835395 17:76579571-76579593 AGTTTCCAACACATAAACTTTGG - Intronic
1152010697 17:77712076-77712098 AGTTTCCAACACATGAAATTTGG - Intergenic
1153268210 18:3292939-3292961 AGTTTACAACACATGAACTTTGG + Intergenic
1154287630 18:13075043-13075065 AGTTTCCAATACAGAAATTTGGG - Intronic
1155627093 18:27846821-27846843 ACTTTTCAACACACAAACTTGGG + Intergenic
1155705999 18:28813629-28813651 AGTTTCCAACATATAAAATTGGG + Intergenic
1155935952 18:31754246-31754268 AGTTTACAACACATAAATTTGGG + Intergenic
1156148302 18:34213184-34213206 AGTTTCCAACACAGGAACTTCGG - Intronic
1156386333 18:36608483-36608505 AGTTTCCAACACATGAACTTTGG + Intronic
1156737840 18:40283408-40283430 TGTTTCCTAAACACAATCTCTGG - Intergenic
1157820741 18:50766662-50766684 AGTTTCCAACACATGAATTTTGG - Intergenic
1158034197 18:53004871-53004893 AGTTTCCAACATATGAACTTTGG - Intronic
1158090452 18:53705966-53705988 ATCTTCCAACACATAAATTCTGG + Intergenic
1158093295 18:53740812-53740834 AGTTGCCTAGTCACAAACTCTGG - Intergenic
1158152523 18:54388580-54388602 AGTTTCCAACACATGAATTTAGG + Intergenic
1158618624 18:59010801-59010823 AGTTTCCAACACATGAATTTTGG + Intergenic
1158992039 18:62879114-62879136 TGTTTCCAACACATCAACTTTGG - Intronic
1159270286 18:66140379-66140401 TGTTTCCAACACATGAACTTTGG + Intergenic
1159545640 18:69837477-69837499 AGCTATCAACACACAAACTTTGG + Intronic
1159700618 18:71622189-71622211 GGTTTCCAACATGCAAACTTTGG - Intergenic
1159714881 18:71809150-71809172 ATTTTCCACCAAATAAACTCTGG - Intergenic
1159758442 18:72394777-72394799 AGTTTCGAACTCACGACCTCAGG - Intergenic
1159820108 18:73130835-73130857 AGTTTCCAACACATGAAATTGGG - Intergenic
1159942788 18:74421323-74421345 AGTTTCCAACACATGAACTTTGG - Intergenic
1160037335 18:75314167-75314189 AGTTTCCAACACATGAACTTTGG - Intergenic
1160450664 18:78963930-78963952 AGTTTTCAACACATGAACTTGGG + Intergenic
1160595179 18:79968540-79968562 GGTCTCCAACTCACAACCTCAGG + Intronic
1160651019 19:228040-228062 AGTTTCCAGCACATAAACTTTGG + Intergenic
1160808794 19:1004079-1004101 TGTCTCAAACACACAAAGTCAGG + Intronic
1163939820 19:20481345-20481367 GGTGTCCAACTCACAACCTCAGG + Intergenic
1164500366 19:28814580-28814602 AGTTTCCAGCACATGAACTTTGG + Intergenic
1164614966 19:29661976-29661998 AGTTTCCAAAACAAAAAATTGGG - Intergenic
1164657395 19:29933245-29933267 AGTTTCCAACAAAAAAGCGCAGG - Intronic
1164972395 19:32543801-32543823 AGTTTCCAACGCCTAACCTCAGG - Intergenic
1165218118 19:34291734-34291756 AGTTTCCAATACAAGAACTTTGG + Intronic
1165521376 19:36316876-36316898 AGTTTCCAACACATGAACTTTGG + Intergenic
1165622685 19:37261713-37261735 AGTTTCCAACACATGAACTTCGG - Intergenic
1165634389 19:37328347-37328369 AGTTTCCAACACATGAACTTTGG - Intronic
1165994621 19:39834941-39834963 CGTTTCCAACACATGAACTTTGG - Intronic
1166031891 19:40137529-40137551 AGGTTCCAACACACGAATTGTGG + Intergenic
1166051163 19:40261119-40261141 AGTTTCCAACACATGAACTTTGG - Intronic
1166911545 19:46162316-46162338 AGAAGCCAACACACAAATTCAGG - Intergenic
1167416649 19:49376893-49376915 AGTTTCAAACTCCCAACCTCGGG + Intergenic
1167500131 19:49841561-49841583 AGTCTCCAACTCCCAACCTCAGG - Intergenic
1202684930 1_KI270712v1_random:40530-40552 GGTTTCAAACTCACAACCTCAGG - Intergenic
924986313 2:273273-273295 AGTTTCCAACAAAGGAACTTTGG + Intronic
925055524 2:854088-854110 AGTTTCCAACACACAAACATTGG - Intergenic
925258712 2:2511492-2511514 GGTTTCCAACACATCAACTTTGG - Intergenic
926283779 2:11471438-11471460 AGTTTCCAACACATGAATTCTGG + Intergenic
926402344 2:12510706-12510728 CGTTTCCAGCACATAAACTTTGG - Intergenic
926442328 2:12902837-12902859 AGTTTCCAACACATGAAATTTGG + Intergenic
926663410 2:15493321-15493343 CATTTCCAAGGCACAAACTCTGG - Intronic
926851532 2:17203442-17203464 AGTTTACAACACATAAACCTTGG + Intergenic
927218310 2:20682757-20682779 AGTCTCTAACACACGAACTTTGG + Intergenic
927828572 2:26327960-26327982 AGTTTCCAACACATGAACTTTGG + Intronic
928467648 2:31537725-31537747 AATTTCCAGCACACAAATTTTGG - Intronic
928581554 2:32712922-32712944 AGTTTCCACCACATCAACTTTGG - Intronic
928631079 2:33193011-33193033 AGTTTCTAACACATGAACTTTGG + Intronic
928822609 2:35380155-35380177 AGTTTCCAACATATGAACTTTGG - Intergenic
928844923 2:35659776-35659798 AGTTTCCAACACATGAATTTTGG + Intergenic
929027954 2:37623419-37623441 AGTTTCCAACACATGAAATCTGG - Intergenic
929493820 2:42422161-42422183 ACTTTCCAACACATAAACTTTGG - Intronic
930259318 2:49126499-49126521 AGTTTCCAACACATAAACTTTGG + Intronic
930345890 2:50180441-50180463 AGTATCCAACACACATATTCTGG - Intronic
930361844 2:50390565-50390587 AGTTTCTAACACATGAACTTTGG - Intronic
930402544 2:50908690-50908712 AGTTTTCAACACACAAAATTTGG - Intronic
930488070 2:52033950-52033972 AGTTTCTAACACATGAACTTTGG - Intergenic
930674691 2:54187798-54187820 AGTTTCCAACACATGAATTCTGG - Intronic
930876346 2:56222118-56222140 AGTTCCCAACACATGAACTATGG + Intronic
931073649 2:58684488-58684510 AGTTTCCAACACACGTTTTCTGG - Intergenic
931381074 2:61753921-61753943 AGTTTCCAGCACATGAACTTTGG + Intergenic
931396969 2:61896188-61896210 AGTTTCCAACACATGAATTTTGG - Intronic
931401111 2:61932561-61932583 AGTTTCCAACATATGAAATCTGG - Intronic
931439969 2:62282387-62282409 AGTTTCTAACACATGAACTTTGG - Intergenic
931861534 2:66359845-66359867 AGTTTCCAACACATGAACTCTGG - Intergenic
932061363 2:68502213-68502235 AGTTTCCAACACATGGACTTTGG + Intronic
932128408 2:69166110-69166132 TATTTCCAACAGCCAAACTCAGG + Intronic
932224435 2:70028571-70028593 AGTTTCCAACACATGAACTTTGG - Intergenic
932470094 2:71949406-71949428 AGTTCCCAACCCACAGATTCTGG - Intergenic
932530712 2:72528725-72528747 AGTTTTCAGCATACAAATTCTGG + Intronic
932562209 2:72883079-72883101 AATTTCCAACACATGAACTTTGG + Intergenic
932683581 2:73848750-73848772 AGTTTCCAAAACATGAACTTTGG + Intronic
932695549 2:73953210-73953232 AATTTCCAACACATGAATTCTGG + Intronic
932802708 2:74755989-74756011 AGTTTCCAACATGCGAACTTTGG + Intergenic
932933551 2:76073900-76073922 AGTTTCCAATACAAATACTTAGG - Intergenic
932985157 2:76717132-76717154 AGTTTTCAACAGAAAAACTAAGG + Intergenic
933365028 2:81342185-81342207 ATTTTAAAACACAAAAACTCTGG - Intergenic
933598047 2:84302494-84302516 CGTTTCCAACACATGAACTTTGG + Intergenic
933795272 2:85914559-85914581 AGTTTCCAACATATGAACTTTGG + Intergenic
933836105 2:86246915-86246937 GGTTTCAAACACCCAACCTCAGG + Intronic
933939473 2:87233443-87233465 GGTTTCCAACACACGAACTTTGG - Intergenic
934246787 2:90314316-90314338 GGTTTCAAACTCACAACCTCAGG + Intergenic
934320395 2:91966541-91966563 AATTTCCAACACATGAACTTTGG + Intergenic
934912425 2:98271877-98271899 AGTTTCCAACACATGAACTCTGG - Intronic
934942501 2:98512729-98512751 AGTTTTCAACACAGGAACTTTGG + Intronic
935307455 2:101751090-101751112 ACTTTCCAACACACCAACAGAGG - Intronic
935517317 2:104056815-104056837 AGTTTCCAACATATGAACTTTGG + Intergenic
935559956 2:104549480-104549502 AGTTTCCAACATAAGAACTTTGG + Intergenic
935635350 2:105245597-105245619 AGTTTCCAACACATGAGCTTTGG + Intergenic
935823915 2:106922807-106922829 AGCTTCCAACACATGAATTCTGG - Intergenic
936012647 2:108934833-108934855 AGTTTTTAACACATAAACTGTGG + Intronic
936045237 2:109182432-109182454 AATTTCCAACACATAAACTTTGG + Intronic
936275658 2:111094681-111094703 AGTTTTCAACACATAAACTTTGG + Intronic
936353662 2:111732330-111732352 GGTTTCCAACACACGAACTTTGG + Intergenic
936438977 2:112533787-112533809 AGTTTCCAACACATTTACTTTGG + Exonic
936752228 2:115658952-115658974 AGTTTCCAACACATAAACTTTGG - Intronic
937460903 2:122084788-122084810 AGTTTTCAACACATTAACTTTGG + Intergenic
937935737 2:127242469-127242491 AGTCTCCAACACATAAAATTTGG + Intergenic
938089273 2:128420487-128420509 AGTTTCCAGCACATGAACTGTGG - Intergenic
938224775 2:129606351-129606373 AGTTTCCAAGGCAGAAAGTCAGG - Intergenic
938736508 2:134191279-134191301 TGTTTCCAACACATGAACTTTGG - Intronic
939140284 2:138346244-138346266 AGTTTCCTACCTAAAAACTCTGG - Intergenic
939354638 2:141085319-141085341 AGGTTTCAACACACAAATTTTGG - Intronic
939499277 2:142962236-142962258 GGTTTCCATCACACAATCTGAGG + Intronic
940515826 2:154682921-154682943 AGTTTCCAACATATAAACTTTGG - Intergenic
940682784 2:156807243-156807265 AGTTTCCAACACATAAATTTTGG + Intergenic
941006309 2:160250828-160250850 ACTTTCCAACACAAGAACTTTGG - Intronic
941529220 2:166644677-166644699 AACTTCCCAAACACAAACTCAGG - Intergenic
941890732 2:170578472-170578494 AGTTTCCAACACCCACTCACTGG - Intronic
942173791 2:173311769-173311791 AGTTTCCAACACATGAACTTTGG + Intergenic
942198975 2:173552028-173552050 AGTTTCCAACACATGAAATCTGG + Intergenic
942288331 2:174444198-174444220 AGTCTCCAACTCCCAACCTCAGG - Intronic
942325351 2:174771826-174771848 AGTTTCCAAAACACAGGCCCTGG - Intergenic
942483162 2:176411276-176411298 AGTTTCCAACACATGAACTTTGG + Intergenic
942543914 2:177043229-177043251 AGTTGCCATCACATAAGCTCAGG - Intergenic
942550138 2:177107257-177107279 AGTTTCCAACACGTGAACTTTGG - Intergenic
943024904 2:182615970-182615992 AGTTTCCAACACATTAACTTTGG + Intergenic
943330180 2:186549627-186549649 AGTTTCCAACACATAAACTTTGG + Intergenic
943395285 2:187325808-187325830 AGTTTCCAGCACATGAACCCTGG - Intergenic
943839873 2:192565670-192565692 AGTTTCCAACATATACACTGTGG - Intergenic
943882460 2:193163741-193163763 AGTATCCAAGACTCAGACTCAGG + Intergenic
944430657 2:199630050-199630072 AGTTTCCAACACATGAACTTTGG - Intergenic
944441757 2:199750448-199750470 AATATCCAACACACCAAGTCAGG + Intergenic
945081841 2:206093895-206093917 AGTTTCCAACATATAAACCTTGG + Intergenic
945084248 2:206115297-206115319 AGTTTCCAACACATGAATTGTGG - Intronic
945099574 2:206251727-206251749 AGATTCCAAGACAAAAAGTCTGG - Intergenic
945390072 2:209254706-209254728 AGTTTCCAACACATGAATTTTGG - Intergenic
945399214 2:209358767-209358789 AGTTTCAAACACAGAAACAGAGG - Intergenic
945964648 2:216173625-216173647 AGTTTCCAACACATAAACTTTGG - Intronic
945972496 2:216244160-216244182 AGTTTGCAACACATGAACTTTGG + Intergenic
945991354 2:216397993-216398015 AGTTTCCAAAACACCAACTTTGG - Intergenic
946500352 2:220240704-220240726 AGTTTCCAACACATGTACTTTGG + Intergenic
946582790 2:221148603-221148625 TGTTTCCAACACATTAACTTTGG - Intergenic
946854427 2:223939191-223939213 ACTTTCCAAATCAGAAACTCTGG + Intronic
946967896 2:225057630-225057652 ATTTTCCAACACATGGACTCTGG - Intergenic
947036454 2:225863654-225863676 AGTTTCCAACACATGAACTTTGG - Intergenic
947487403 2:230564837-230564859 AGTTTCCAACACGTGAACTTTGG - Intergenic
947540624 2:230975086-230975108 AGTTTCCAACACATGAACTTTGG + Intergenic
947866990 2:233405163-233405185 AGTTTCCAACACATGAACTTTGG - Intronic
947966360 2:234284916-234284938 AGTTGCCAACACACGAACTTTGG - Intergenic
1168863973 20:1068440-1068462 AGTTTCCAACACACACATTTTGG + Intergenic
1169410181 20:5362166-5362188 ATTGTCCAACACACAATTTCTGG - Intergenic
1169770434 20:9194301-9194323 ATTTTCCAACACAAAACCACTGG + Intronic
1170261146 20:14409818-14409840 AGTTTCCATCCCACAAACAGTGG - Intronic
1170318916 20:15072836-15072858 AGTTTTCAACACACAAACTTTGG - Intronic
1170794650 20:19536065-19536087 AGTTTCCAACGCATGAACTTTGG + Intronic
1171774481 20:29352585-29352607 AGTTTCCAACACTTGAGCTCCGG + Intergenic
1171816501 20:29790240-29790262 AGTTTCCAACACTTGAGCTCGGG + Intergenic
1172921323 20:38484909-38484931 AGTCTCCAACTCCCAACCTCAGG + Intronic
1173292718 20:41728594-41728616 AGTTTCCAAAACATAAACTTTGG - Intergenic
1173601954 20:44301709-44301731 AGTTTCCAAGACATGAACTTTGG + Intergenic
1173912688 20:46681996-46682018 AGTTTCCAACACATGAAATACGG + Intronic
1174831177 20:53813501-53813523 AGTTTCCAACATACGAACTTTGG - Intergenic
1174926771 20:54768895-54768917 AGTTTCCATCACACAAGTTTGGG + Intergenic
1175012459 20:55753404-55753426 AGTTTCCAATACACGAATTCTGG + Intergenic
1175717683 20:61266283-61266305 AGTGTCCAATACCCACACTCTGG - Intronic
1175981567 20:62741337-62741359 AGATTCCAACTCCCACACTCAGG + Intronic
1176158480 20:63635963-63635985 AGTTTCCAACACGTGAACTTCGG + Intergenic
1177282310 21:18997428-18997450 AGTTTCCAATACATGAACTTTGG - Intergenic
1177324670 21:19568947-19568969 AGTTTCCAACACATGAACTTTGG + Intergenic
1177478533 21:21655313-21655335 AATTTCCAACACATAAATTCTGG + Intergenic
1177521422 21:22232817-22232839 AGTTTCCAACACATAAATGTAGG - Intergenic
1178053247 21:28770501-28770523 AGTTTCTAACACACAAACTTTGG - Intergenic
1178090319 21:29155819-29155841 TGTTTCCAAGACACAGACTGGGG - Intronic
1178113192 21:29390526-29390548 AGTTTCAAACATACACACACAGG - Intronic
1178135848 21:29626375-29626397 AGTTTCCAACACATGAACTCTGG + Intronic
1178170065 21:30030765-30030787 AGTCTCCAACACATAAAATTTGG + Intergenic
1178458511 21:32778982-32779004 AGTTTCCAACACATGAATTTTGG - Intergenic
1178535952 21:33410682-33410704 GGTTTCAAACTCCCAAACTCAGG + Intronic
1178903208 21:36614283-36614305 TGTTTCCAACACATGAACTTGGG - Intergenic
1179254498 21:39703545-39703567 AGTTTCTAACACATAAACTTTGG - Intergenic
1180308639 22:11150597-11150619 AATTTCCAACACATGAACTTTGG + Intergenic
1180319960 22:11310832-11310854 AGTTTCCAACACTTGAGCTCGGG + Intergenic
1180547116 22:16512408-16512430 AATTTCCAACACATGAACTTTGG + Intergenic
1181004725 22:20007519-20007541 AGTTTCCAACACGTGAACTTTGG - Intronic
1182054390 22:27338492-27338514 AGTTTCCAGCACATCAACTTTGG - Intergenic
1182089938 22:27587578-27587600 AGTTTTTAACACACGAACTTTGG + Intergenic
1182389607 22:29981615-29981637 GGTTTCGAACTCACAACCTCAGG - Intronic
1182817549 22:33179174-33179196 AGTTTCCAACACATGAAATTTGG + Intronic
1183959484 22:41402704-41402726 AGTTTCCAACCCATATATTCTGG - Intergenic
1183973101 22:41493242-41493264 AGTTGCCAACACATAAACTTTGG + Intronic
1184007290 22:41719647-41719669 AGTTTCCAACACATGAACTTTGG + Intronic
949224762 3:1681209-1681231 AGTTTCCAACAAATGAACTTTGG + Intergenic
949917920 3:8979234-8979256 AGTTTCCAACACATAAATTTGGG - Intergenic
949965907 3:9356071-9356093 AGTTTCAAACACATGAACTTTGG + Intronic
950141630 3:10620005-10620027 ATTTTCCAAGTCACAAACTGGGG + Intronic
950319217 3:12034781-12034803 AGTTTCCAACACATGAATTTTGG + Intronic
950319580 3:12037764-12037786 AGTTTCCAACATAAGAACTTTGG + Intronic
950896613 3:16457791-16457813 AGTTTCCAACACATAAATTTGGG - Intronic
951272745 3:20647168-20647190 AGTTTCAAACACATGAACTCTGG - Intergenic
951284573 3:20793557-20793579 AGCTTCCAACACATGAACTTTGG + Intergenic
951741177 3:25925354-25925376 AGTTTCCAACATGTAAACTTTGG + Intergenic
951940644 3:28075297-28075319 AGTTTCTAACACTAGAACTCTGG - Intergenic
952149694 3:30574968-30574990 AGTTTCCAACACATAATTTTGGG + Intergenic
952327874 3:32337204-32337226 AGTTTCCAACACATAAAGTTTGG + Intronic
952808878 3:37383886-37383908 AGTTTCCAACACACAAATTTTGG - Intergenic
953144386 3:40261056-40261078 AGTTTCTAACACATGAACTTTGG + Intergenic
953731211 3:45449606-45449628 AGTTTCCAACACATGAACTTTGG + Intronic
953753254 3:45625557-45625579 AGTTTCCAACACTTGAACTGTGG - Intronic
953898868 3:46826889-46826911 AGTTTCCAACACATGAACTTTGG - Intergenic
954934954 3:54317987-54318009 AGTTTCCAATACATGAACTTTGG + Intronic
954956376 3:54522861-54522883 AGTTTCTAACACATGAACTTTGG + Intronic
955137576 3:56234910-56234932 AGTTTCCAACACATAAATTTAGG + Intronic
955301577 3:57784745-57784767 AGTTTCCAACACATGAACCATGG - Intronic
955532533 3:59889085-59889107 CGTTTCTAACACATAAACTTTGG + Intronic
955636681 3:61037547-61037569 AGTTTCCAACACATGGACTTTGG - Intronic
955639393 3:61066262-61066284 AGTTTCCAAAACATAAACTCTGG + Intronic
955944727 3:64182093-64182115 AGTTTCCAACACATGAATTTGGG - Intronic
956109199 3:65853886-65853908 AGTCTCCAACTCCCAACCTCAGG - Intronic
956256010 3:67283844-67283866 AGATTCCAACACACGAACTTTGG + Intergenic
956334824 3:68151766-68151788 AGTTTCCATCACATGAACTTTGG + Intronic
956533413 3:70247794-70247816 GGTTTCAAACACACAAAATAGGG + Intergenic
956562548 3:70596352-70596374 AGTCACCCACACACAATCTCAGG - Intergenic
956765475 3:72480982-72481004 AGTTTCCAACACATGAATTTTGG - Intergenic
957122583 3:76114196-76114218 AGTTTCCAACACATGAACTTTGG + Intronic
957218915 3:77357178-77357200 AGTTTCCATCACATGAACTTTGG - Intronic
957736598 3:84211616-84211638 AGTTTCCAACCTATAAACTTTGG - Intergenic
957835100 3:85577239-85577261 AGCTTCCAACACATGAACTCCGG - Intronic
957891276 3:86362397-86362419 AGTTTCCAACACATGAAATCTGG + Intergenic
958555605 3:95672684-95672706 AGTTTCCACCACATGAACTTTGG + Intergenic
959196237 3:103186838-103186860 AATTTCTGACACACAAACTTTGG - Intergenic
959523622 3:107349737-107349759 AATTTCCAACCCACAAAACCAGG - Intergenic
959633860 3:108539102-108539124 AGTTTCCTACACATGAACTTTGG + Intergenic
959798558 3:110462454-110462476 AGTTTCCAACACATGAATTTTGG + Intergenic
959940669 3:112077631-112077653 AGTTTCCAGACCAGAAACTCAGG + Intronic
960145730 3:114199535-114199557 AATTTCCAACACACAAACTTTGG + Intergenic
960146267 3:114207118-114207140 AGTTTCTAACACATGAACTTTGG + Intergenic
960471015 3:118065248-118065270 AGGTTTCAACATACAAATTCTGG + Intergenic
960593143 3:119384740-119384762 AGTTCCCAACACATGAACTTTGG + Intronic
960645469 3:119876665-119876687 AGTTTCCAACACATGAGCTTTGG - Intronic
960772091 3:121205501-121205523 AGTTTCCAACACATGAATTTTGG + Intronic
960859414 3:122136303-122136325 AGTTTCTAACACATAAACTTTGG + Intergenic
961060154 3:123821878-123821900 AGTTTCCAAAACATGAATTCTGG - Intronic
961314075 3:126022639-126022661 AGTTTCCAACACATGAAATGTGG + Intronic
962004116 3:131331083-131331105 AGTTTCCAACACATGAACCTTGG + Intronic
962067570 3:131998031-131998053 AGTTTCCAACACATGAACTTTGG + Intronic
962172504 3:133116984-133117006 AGTCTCCAACTCCCAACCTCAGG + Intronic
962177493 3:133169219-133169241 AGTTTCCAACAAATGAACTTTGG + Intronic
962269647 3:133968285-133968307 AATTACCCACAAACAAACTCAGG + Intronic
962321477 3:134394154-134394176 AGTTTCCAATACATGAATTCTGG + Intergenic
962430345 3:135313058-135313080 AGTTTTTAACACATAAACTTTGG + Intergenic
962592903 3:136908874-136908896 ACTTTCCAACACATTAACTTTGG - Intronic
962803051 3:138906601-138906623 AGTTTCCAACACATGAACTTCGG + Intergenic
963526024 3:146414260-146414282 AGTTTCCAGCACATGAACTTTGG + Intronic
964193662 3:154036078-154036100 AGTTTCTAACACATAAATTTTGG - Intergenic
964517950 3:157533179-157533201 AGGGTCCAAAACACAAAGTCTGG + Intronic
964578969 3:158209159-158209181 AGTTTCCAACACAAAAACTTTGG - Intronic
964781345 3:160341690-160341712 ACTTTCCAGCACATAAACTGAGG + Intronic
964815408 3:160712411-160712433 AGTATCCATCAGAAAAACTCTGG + Intergenic
965000077 3:162942034-162942056 AGTTTTCAACACATAAACTTTGG - Intergenic
965117165 3:164505197-164505219 ATCTTCCAACAAAAAAACTCAGG - Intergenic
965959086 3:174407379-174407401 AGTTTCCAACACATGAAATTTGG + Intergenic
966029422 3:175326884-175326906 AGTTTCCAACACATGAGCTGTGG + Intronic
966240387 3:177749340-177749362 AGTTTCCAACATAAAATCTTTGG - Intergenic
966288768 3:178329735-178329757 AGTTTCCAACACATGAATTTTGG + Intergenic
966555634 3:181257375-181257397 AGTTTCCAACACATAAACTTTGG + Intergenic
966762718 3:183431449-183431471 AGTTTCCAACACATGAACTTTGG - Intergenic
967177240 3:186872394-186872416 AGTTTCCAACACATAAATTTGGG + Intergenic
967302973 3:188034907-188034929 AGTTTTCAACACATCAACTTTGG - Intergenic
967750969 3:193115917-193115939 AGTTTTCAACACATAAATACTGG - Intergenic
968008558 3:195259002-195259024 AGTTCCCAACACACCTATTCCGG + Intronic
968205822 3:196799383-196799405 AGTTTCTAACACATGAACTCTGG - Intronic
968366811 3:198191947-198191969 AGTTTCCAGCACATAAACTTTGG - Intergenic
968733254 4:2281676-2281698 AGTTACCAACACATGAACTTTGG + Intronic
969147197 4:5134224-5134246 AGTTTCCAACACATAAACTTTGG - Intronic
969579103 4:8053659-8053681 AGTTTCCAACACACAAATTTTGG - Intronic
970155606 4:13139004-13139026 AGTTTCCAACACGTGAAATCTGG - Intergenic
970222974 4:13829452-13829474 AGTTTCCAACACAAGAAATTTGG - Intergenic
970261477 4:14229534-14229556 AGTTTTCAACACATGAACTTTGG + Intergenic
970659995 4:18274637-18274659 AGCTTCCCACACAAACACTCAGG + Intergenic
971194112 4:24455574-24455596 AGTTTCCAACACTTGAACTTTGG - Intergenic
971302760 4:25455656-25455678 AGTTTCCAACACATGAACTTTGG + Intergenic
971465162 4:26950431-26950453 AGCTTCCAACACATAAATTTTGG - Intronic
971820465 4:31547138-31547160 AGTTTCAAACACATAAACTTTGG - Intergenic
971993696 4:33935463-33935485 AGTCTCCAACACACAAACTTTGG - Intergenic
972110345 4:35550215-35550237 AGTTTACAACACACACATTTTGG + Intergenic
972566588 4:40274987-40275009 AGTTTCCAACACATGAGCTTTGG + Intergenic
972622511 4:40761938-40761960 AGTTTCCAATACATGAATTCTGG - Intronic
972688952 4:41377971-41377993 AGTTTTCAACACATGAATTCTGG + Intronic
972851319 4:43053973-43053995 AGTTTCTAACACATGAACTTTGG - Intergenic
974024543 4:56721851-56721873 AGTTTCCAGCACATGAACTTTGG - Intergenic
974095799 4:57362452-57362474 AGTTTCCAACACATGAATTTTGG + Intergenic
974115379 4:57572344-57572366 AGTTTCTAACACATGAACTTTGG + Intergenic
974155823 4:58070879-58070901 GGTTTCCAGCACATAAATTCTGG - Intergenic
974355908 4:60812481-60812503 AGTTTCCAACACATGAACTTTGG + Intergenic
974438810 4:61890706-61890728 AGTTTCTAACACATGAACTTTGG + Intronic
974514155 4:62886629-62886651 AGTTTCCAACACATGAACTTTGG - Intergenic
974874395 4:67685598-67685620 AGTTTCCAACACACAAACTCCGG - Intronic
975458451 4:74621599-74621621 AGTTTCAAACAAACAAGCTTAGG + Intergenic
975859887 4:78665610-78665632 AGTTTCCAACACATGAACTTTGG - Intergenic
975939179 4:79620622-79620644 AGTTTTTAACACATGAACTCTGG + Intergenic
976224094 4:82781548-82781570 AGTTTCCAACACATGAACTTAGG - Intronic
976320467 4:83708626-83708648 AGATTCCAACACAGAAAAGCAGG - Intergenic
976376345 4:84349939-84349961 AGTTTCCAACACATGAAATTTGG + Intergenic
976446489 4:85135846-85135868 AGTTTCCAACACATGAGCTTTGG + Intergenic
976539866 4:86262089-86262111 AGTTTCCAACACAGGAACTTTGG - Intronic
976599079 4:86921181-86921203 AGTTTTCAACATACAAACTTTGG + Intronic
976633002 4:87258759-87258781 AGTTTCCAACACATGAACTTTGG - Intergenic
976785202 4:88811848-88811870 AGTTTCTAACACATAAACTTTGG - Intronic
976841204 4:89434039-89434061 AGTTTCCAATACATGAACTTTGG - Intergenic
976953465 4:90864316-90864338 TGTTTCCAACACATGAACTTTGG - Intronic
977067372 4:92334726-92334748 AGATTCCAACACATAAATTTTGG + Intronic
977073051 4:92417368-92417390 AGTTTCCAACACATGAATTTTGG - Intronic
977192725 4:94021013-94021035 AGTTTCCAACACATAAACTTTGG - Intergenic
977320103 4:95503068-95503090 AGTTTCCAACACATGAATTTTGG - Intronic
977421391 4:96804553-96804575 AGTCTCCAACACATGAACTTTGG - Intergenic
977590372 4:98819649-98819671 AGTATCCAACACATAAACTTCGG - Intergenic
977903918 4:102454660-102454682 AGTTTCCAACACATGAAATCTGG + Intergenic
977976347 4:103271054-103271076 ATGTTCCAACACACAAATTTTGG + Intergenic
977983647 4:103356912-103356934 AGTTCCCAACACATGAACTTTGG + Intergenic
978264452 4:106805515-106805537 AGTTTCCAACGCATATACTTAGG - Intergenic
978330245 4:107604628-107604650 AGTTTCCAACACATGAACTTTGG + Intronic
978423235 4:108556292-108556314 AGTTTCCAGCACATAAACTTCGG + Intergenic
978488858 4:109288596-109288618 ATTTTCCAAAACACAAAGTGAGG + Intronic
978524592 4:109652726-109652748 GGTTTCCAACACATGGACTCTGG + Intronic
978526773 4:109675629-109675651 AGTTTCCAACACATCAACTTTGG - Intronic
978535242 4:109755423-109755445 AGTTTCCAACACATGAACTTTGG - Intronic
978723463 4:111942260-111942282 AGTTTCCAACACATGAACTTTGG + Intergenic
979206511 4:118044984-118045006 AATTTCCAGCACACAAACTTTGG + Intronic
979255224 4:118601556-118601578 AGTTTCCAGCACATAAACTTTGG - Intergenic
979333112 4:119438952-119438974 AGTTTCCAGCACATAAACTTTGG + Intergenic
979415968 4:120439280-120439302 AGTTTCCAACACATGAATTTGGG - Intergenic
979418194 4:120469687-120469709 AGTTTCCAAGACATAAAATTTGG - Intergenic
979791252 4:124784224-124784246 AGTTTCTAACACATGAACTTTGG - Intergenic
979932943 4:126655307-126655329 AATTTCTAACACATAAACTTTGG - Intergenic
980044077 4:127969413-127969435 GGTCTCCAACTCCCAAACTCAGG + Intronic
980049437 4:128024387-128024409 AGTTTCCAACACATGAACTTTGG + Intronic
980119648 4:128714489-128714511 AATTTCCAACACATAAAATCTGG + Intergenic
980237481 4:130128231-130128253 AGTTTCCAACACATGAAATTTGG - Intergenic
980278579 4:130687864-130687886 AGTTTCTAACACATACACTTTGG - Intergenic
980311257 4:131132522-131132544 GGTTTCCAACACATAAATTTTGG - Intergenic
980451858 4:132984185-132984207 AATTTTCAACACACAAACTGTGG - Intergenic
980763663 4:137270343-137270365 AGTTTCCAACATATAAAATTTGG + Intergenic
981530044 4:145743565-145743587 AGTTTTCAACACATGAACTTTGG + Intronic
981548131 4:145915582-145915604 AGTTTCCAACATATGAATTCTGG + Intronic
981621392 4:146703606-146703628 AGTTTCCAACACGTGAACTTTGG + Intergenic
981796978 4:148606338-148606360 AGTTCCCAACACATGAACTTTGG - Intergenic
981961854 4:150550950-150550972 AGTTTCCAACACATGAACTTTGG - Intronic
982086207 4:151839350-151839372 AGTTTCCAACACATGAATTGTGG - Intergenic
982286957 4:153745907-153745929 TGTTTCCAACACATGAACTTTGG + Intronic
982719302 4:158843003-158843025 ATTTCTCAACACACAAACACAGG - Intronic
982787306 4:159550697-159550719 AGTTTCCAACACATGAACTTTGG + Intergenic
982977094 4:162077360-162077382 AGTTTCCAACACATAAACTTTGG + Intronic
982994238 4:162320297-162320319 AGTTTCCAACACATGAACTTTGG + Intergenic
983021582 4:162683249-162683271 AGTTTCCAACACATGAACTTTGG + Intergenic
983214681 4:164992055-164992077 AGTTTCAAACTCCCGAACTCAGG - Intergenic
983283926 4:165715556-165715578 AGTTTCCAACACATGAATTTTGG - Intergenic
983452840 4:167928847-167928869 AGTTTGCAACACACAAATTTTGG - Intergenic
983671245 4:170240310-170240332 AGTCTCCAACACATAAACTTTGG + Intergenic
983743098 4:171159977-171159999 AGTTTTCAAAGGACAAACTCTGG + Intergenic
983884883 4:172969738-172969760 CGTTTCCAACACATGAACTTTGG - Intronic
984103496 4:175515785-175515807 AGTTTCCAACACATCAACTTTGG - Intergenic
984273134 4:177572785-177572807 AGTTTACAACACATGAACTTTGG + Intergenic
984309498 4:178038694-178038716 AGTTTCCAACACATGAACTTTGG + Intergenic
984389343 4:179109214-179109236 AATTTCCAACACATGAACTTTGG - Intergenic
984475577 4:180230408-180230430 AGTTTCTAACACATTGACTCTGG + Intergenic
984789190 4:183599220-183599242 AGTTTCCAACACATAAATTTTGG - Intergenic
985073063 4:186187493-186187515 AGTTTCCAACACATGAACTTTGG - Intergenic
985112247 4:186557608-186557630 AATTTTCCACACACAAATTCTGG - Intergenic
985238719 4:187905839-187905861 AGATTTCAACACACAAATTTTGG + Intergenic
985771170 5:1812333-1812355 AGTTTCCAACAGAGGAACTTTGG + Intronic
986147708 5:5094769-5094791 AGTTTCCAGCACATAAACTCTGG + Intergenic
986748893 5:10767503-10767525 AGTTTCCAACACATGAATTTTGG - Intergenic
986874344 5:12088973-12088995 AGTTTCCAACACATGAAATTTGG + Intergenic
987041903 5:14070755-14070777 AGTTTCCAACACATCAACTTTGG + Intergenic
987110451 5:14681146-14681168 AGTTTCCAAAACACAAAGGGGGG - Intronic
987271905 5:16318660-16318682 AGCTTCCAACATATAAACTTTGG - Intergenic
987349159 5:17006232-17006254 AGTTTAAACCACACAAGCTCTGG - Intergenic
987472158 5:18345500-18345522 AGTTTTCAACAAATAAACTCTGG + Intergenic
987477766 5:18412899-18412921 AGTTTCCAGCACATGAACTTTGG - Intergenic
987648352 5:20706463-20706485 GGTTTCCAACACATAAACTTTGG - Intergenic
987969715 5:24927022-24927044 AGTTTCCAACACATGAATTTTGG - Intergenic
988077783 5:26374434-26374456 AGTTTGCAACACATAAATTCTGG - Intergenic
988100989 5:26677946-26677968 AGTTTTAAAGACACAATCTCTGG - Intergenic
988292223 5:29301801-29301823 AGTTTCCAACACATAAATTCTGG + Intergenic
988301978 5:29441668-29441690 ATTTTTCAATACACAAACTTAGG + Intergenic
988326443 5:29774588-29774610 AGTTTCCAACACATGAGCTGTGG - Intergenic
988610710 5:32722059-32722081 AGTTTTCAACACATGAAATCTGG + Intronic
988655236 5:33204195-33204217 AGTTTTCAACATACAAATTGGGG - Intergenic
988747974 5:34162450-34162472 GGTTTCCAACACATAAACTTTGG + Intergenic
989016413 5:36939923-36939945 AGTTTCCAACAAATGAACTTTGG + Intronic
989340395 5:40367767-40367789 AGTTGCCAACACATAAATTTGGG + Intergenic
989398609 5:40984987-40985009 AGTTTCCAACACATGAACTTTGG + Intergenic
989463480 5:41727616-41727638 TGTTTCCAACATACACACTGTGG + Intergenic
989680556 5:44023545-44023567 AGTTTCCAACACATAAATTTGGG - Intergenic
989686123 5:44089488-44089510 AATTTCCAACACACAGGGTCTGG + Intergenic
990091279 5:52052835-52052857 AGTTTCCAACACATGAATCCGGG + Intronic
990180460 5:53155207-53155229 AGTTTCCAACACATAAAATCTGG - Intergenic
990319265 5:54613547-54613569 TGTTTCCAACACAAGAACTTTGG + Intergenic
990669642 5:58113460-58113482 AGTGTTCTGCACACAAACTCTGG + Intergenic
991568093 5:68025906-68025928 AGTTTCCAACACATAAATTTGGG + Intergenic
991604445 5:68386271-68386293 AGTTTCCAACACATGATCTTTGG - Intergenic
991929662 5:71740727-71740749 AGTTCCCCACACACAAAATTTGG + Intergenic
991953739 5:71971864-71971886 AGATTCCAACACATAAATTTTGG + Intergenic
992270575 5:75058840-75058862 AGTTTCCAACACATGAACTTTGG + Intergenic
992400998 5:76411452-76411474 ACGTTCCAACACACGAACTTTGG - Intronic
992475616 5:77098993-77099015 AGTTTCTAACACATAAATTTTGG + Intergenic
992988166 5:82254824-82254846 ATTTTCCCACAATCAAACTCAGG + Exonic
993068201 5:83127228-83127250 AGTTTTCCACACACAAATTTTGG - Intronic
993388473 5:87288739-87288761 ATTTTCCAACACAAATACTTGGG - Intronic
994619492 5:102146207-102146229 AGTTTCCAACACCTGAACTTTGG + Intergenic
994885690 5:105558504-105558526 AGTTTCTAACACACAAATTTGGG - Intergenic
995572499 5:113495071-113495093 AGTTTCCAACACATGAACTTTGG + Intergenic
995788189 5:115854235-115854257 AATTTCCAACACATGAACTTTGG + Intronic
996189004 5:120515342-120515364 AGTTTCCAACACTTAAGCTTTGG + Intronic
996231865 5:121074281-121074303 AGGTTCCAATACACAAATTTTGG + Intergenic
996338741 5:122412961-122412983 AGGTCTCAACACACAAATTCTGG - Intronic
996343151 5:122460306-122460328 AGTTTCCAATACGCAAAATTAGG - Intronic
996504195 5:124251099-124251121 AGTTTCCAACACATAAACTCTGG - Intergenic
997002594 5:129780179-129780201 AGTTATCAACACATAAACTTTGG + Intergenic
997107729 5:131040358-131040380 AGGTTTCAACACACAAATTTTGG - Intergenic
997231660 5:132249183-132249205 AGTTTCCAACACATGAACTCTGG + Intronic
997296326 5:132771216-132771238 GGTTGCCAACACACAAAAACAGG + Intronic
997989342 5:138531053-138531075 AGTTTCCAACACATGAATTTGGG - Intronic
998057682 5:139092854-139092876 AGTTTCCAACACATGAACTTTGG - Intronic
998238796 5:140423780-140423802 AGTTTCTAACACATGAACTTTGG - Intronic
998593745 5:143505767-143505789 AGTTTCCAACACATGAACTTTGG + Intergenic
998741452 5:145207148-145207170 AGTTTCCAATACATAAATTTTGG + Intergenic
998871660 5:146558542-146558564 AGTTTCCAATACATAAAATTTGG - Intergenic
999038361 5:148379048-148379070 AGTTTGCAACACATGAACTTTGG + Intergenic
999706955 5:154282312-154282334 AGTTTCCAACACACAAACTTTGG + Intronic
1000017196 5:157288368-157288390 AGTTTCTAACACATGAACTTTGG + Intronic
1000256392 5:159542467-159542489 AGTTTCCAACACATGAATTTTGG - Intergenic
1000694011 5:164358117-164358139 AGTCTGCAGCACACAAAATCTGG - Intergenic
1001361909 5:171094881-171094903 AGTTTCAAACACACAAACTTTGG - Intronic
1001830869 5:174788370-174788392 AGTTTCCAACACATAAACTTTGG + Intergenic
1002331883 5:178448761-178448783 AGTTTCCCACACATGAAGTCTGG + Intronic
1002676321 5:180916241-180916263 AGTTTTCAACACATAAACTCTGG + Intronic
1002726034 5:181297147-181297169 AGTTTCCAGCACATAAACTTTGG - Intergenic
1002792079 6:444229-444251 AGTTTCTAACCCACTAACTGGGG + Intergenic
1002919878 6:1560451-1560473 AGTTTCCAACACAGGAACTTTGG + Intergenic
1003163588 6:3656869-3656891 AGTTTCCAACACTTGAAATCTGG + Intergenic
1003263083 6:4540961-4540983 AGTTTCCAATACATGAACTTTGG - Intergenic
1003401957 6:5797883-5797905 AGTTTCCAACACATGAACTTTGG - Intergenic
1003629684 6:7775145-7775167 AGTCTCCAACACATGAACTTTGG + Intronic
1003839692 6:10107105-10107127 AGTTTCCAACACATGAATTTTGG - Intronic
1003896142 6:10609512-10609534 AGTTTCCAACACATGAATTTTGG + Intronic
1004228270 6:13807974-13807996 AGTTTTCAACACATAAACTTTGG - Intronic
1004249920 6:14015388-14015410 AGTTTCCAACACATAAACTTTGG + Intergenic
1004325932 6:14674066-14674088 AGTTTCCAACATATGAAATCTGG - Intergenic
1004414591 6:15413901-15413923 GGTTTCCAACACATGAACTTTGG + Intronic
1005118636 6:22366044-22366066 ACTTTCCAACACATTAACTGTGG + Intergenic
1005229796 6:23686381-23686403 AGTTTCCAACACATAAACTTTGG + Intergenic
1005368657 6:25106649-25106671 AATTTCCAAGATAAAAACTCCGG - Intergenic
1005393876 6:25361657-25361679 AGTTTCCAACACATGAAATTTGG - Intronic
1005545558 6:26865537-26865559 GGTTTCCAACACATAAACTTTGG + Intergenic
1005641661 6:27802081-27802103 AGTTTCCAACACATTAATTTTGG - Intergenic
1005857202 6:29871660-29871682 AGTCTCCAACTCCCAACCTCAGG - Intergenic
1005878481 6:30034542-30034564 AGTTTCCAACACATGAACTTTGG - Intergenic
1005937447 6:30534190-30534212 AGTTTCCAGCACACCACCTTTGG - Intergenic
1006401769 6:33821863-33821885 AGTTTCCAACACATGAACTGTGG - Intergenic
1006791344 6:36703313-36703335 AGTTTCCAACACATGAACTTTGG + Intronic
1006843133 6:37043802-37043824 AGTTTCCAACACATGAACTTTGG + Intergenic
1007209484 6:40180804-40180826 AGTTTCCAACACATGAACTTTGG + Intergenic
1007280657 6:40709952-40709974 AGTTTTCAACACATGAACTTTGG + Intergenic
1007548449 6:42711075-42711097 CGTTTCCAACACAGGAACTTTGG - Intronic
1007755982 6:44099935-44099957 AGTGTCCACAACACAAACTGAGG + Intergenic
1007818399 6:44541489-44541511 AGTTTCCAACACATGAATTTTGG + Intergenic
1008024087 6:46614398-46614420 AGTTTCCATCACACAAGAACCGG + Intronic
1008188550 6:48425315-48425337 AGTTTCCGACACATAAACTTTGG + Intergenic
1009016260 6:57906303-57906325 GGTTTCCAACACATAAACTTTGG + Intergenic
1009583511 6:65566964-65566986 AGTTTCCAACACATGAAATCTGG - Intronic
1009760258 6:67996206-67996228 AGTTTCCAACATATGAACTTTGG - Intergenic
1010155875 6:72791952-72791974 AGTTTTCAACACATGAACTTTGG + Intronic
1010303023 6:74283431-74283453 ATTTTGCTACACACAACCTCAGG - Intergenic
1010514802 6:76760258-76760280 AGTTTCCAACACATGAACTTTGG + Intergenic
1010521121 6:76838991-76839013 AGTTTCCAACACATGAATTTTGG - Intergenic
1011084840 6:83528114-83528136 AGGTTTCAACATACAAACTTTGG + Intergenic
1011415103 6:87110571-87110593 AGTCTCCTACATCCAAACTCTGG + Intergenic
1012390796 6:98737327-98737349 AGTTTCCAACACACAAATTCTGG + Intergenic
1012433561 6:99191127-99191149 AATTTCCAACACATGAATTCTGG - Intergenic
1012723078 6:102772798-102772820 AGTTTCCAACACAGGAAATGTGG - Intergenic
1012844320 6:104370292-104370314 AGTTTCCAACACATTAAATTTGG - Intergenic
1012859265 6:104540058-104540080 AATTTCCAACACATAAACTTTGG + Intergenic
1012859421 6:104541571-104541593 AGTTTCCAACACATGCACTTTGG + Intergenic
1013427614 6:110028083-110028105 AGTTGCCAACACACAAATTTTGG + Intergenic
1013545205 6:111150057-111150079 AGTTTCCAACAAATGAACTTTGG - Intronic
1013705815 6:112832809-112832831 AATTTTCAAACCACAAACTCAGG + Intergenic
1013869403 6:114739269-114739291 AGTTTCCAACACATGAATTTGGG - Intergenic
1013891140 6:115028787-115028809 AGTTTCCAACACATATAAGCTGG - Intergenic
1013981006 6:116129364-116129386 AGTTTCCAACACATGAACTTTGG - Intronic
1014074812 6:117223821-117223843 AATTTCCAACACACAAATTTTGG - Intergenic
1014400609 6:120985420-120985442 AGTTTCCAGTACATAAACTTTGG - Intergenic
1015203366 6:130607121-130607143 CTTTTCCAACACATAAACTTTGG - Intergenic
1015518865 6:134112143-134112165 AGCTACCAACACATAAACTTTGG - Intergenic
1015581694 6:134731830-134731852 AGTTTCCAATTCAGTAACTCTGG + Intergenic
1015665746 6:135626550-135626572 AGATTCCAACACATGAACTTTGG - Intergenic
1015854736 6:137611399-137611421 AGATTCCATCAGAAAAACTCTGG + Intergenic
1016207687 6:141489847-141489869 AGTTTTCAACACACAAACTTTGG + Intergenic
1016673485 6:146735581-146735603 AGTTTCTAACACATAAAGTTAGG + Intronic
1016906254 6:149153310-149153332 AGTTTCCAACACATGCACTTTGG - Intergenic
1017190753 6:151650266-151650288 TGTTTCCAACATAAAAAATCAGG - Intergenic
1017486662 6:154908615-154908637 AATTTCCAAAACATAAATTCTGG - Intronic
1017574363 6:155785931-155785953 AGTTTTCAACACATAAACTTTGG - Intergenic
1017768330 6:157625147-157625169 AGTTTCCAACACACGAACTTCGG + Intronic
1018004032 6:159603628-159603650 AGCTTCCAACACATGAACTTTGG + Intergenic
1018045345 6:159960887-159960909 AGTTTCCAACATATGAACTTTGG + Intergenic
1018141098 6:160837843-160837865 AGTGCCCATCAAACAAACTCAGG - Intergenic
1018175126 6:161171931-161171953 AGTTTCCAACACATGAACTCTGG + Intronic
1018988795 6:168657920-168657942 AGTTTCCAGCACATGAACTTTGG + Intronic
1019390854 7:786488-786510 AGTTACCAACTCACAAAGTCAGG - Intergenic
1019804638 7:3114301-3114323 AGTTTCCAACACATGGACTTTGG - Intergenic
1020390199 7:7649480-7649502 AGTTTCTAACACATGAACTTTGG + Intronic
1020430138 7:8110164-8110186 AATTTCCAACACATGAACTTTGG - Intergenic
1021774106 7:24035044-24035066 AGTTTTCAACACATGAACTTTGG + Intergenic
1022150319 7:27596387-27596409 AGTTTCTAACACATGAATTCTGG + Intronic
1022538824 7:31116529-31116551 AGTTTCCATAAAACAAAATCAGG - Intergenic
1022737690 7:33091143-33091165 AGTTTCCAACGCAGGAATTCTGG + Intergenic
1022747834 7:33190727-33190749 TGTTTCCAACTCACAGGCTCTGG + Intronic
1023029721 7:36081459-36081481 AGTTTCCAACACATGAACACTGG - Intronic
1023397322 7:39763373-39763395 AGTTTCCAGCACATAAACTTTGG - Intergenic
1024070927 7:45784714-45784736 AGTTTCCAGCACATAAACTTTGG - Intergenic
1024660469 7:51488148-51488170 AGTTTCCAACATATGAACTTTGG - Intergenic
1024710852 7:52012798-52012820 AGTTTCCAACACATGAACTTTGG - Intergenic
1025135348 7:56407092-56407114 AGTTTCCAGCACATAAACTTTGG + Intergenic
1025828115 7:65026937-65026959 AGTTTCCAACACATGAACTTTGG - Intergenic
1025915645 7:65863370-65863392 AGTTTCCAACACATTAACTTTGG - Intergenic
1026040582 7:66865231-66865253 AGTTTCCAGCACATAAACTTTGG - Intergenic
1026126094 7:67580933-67580955 AGTTTCCAACACATGAATTTTGG + Intergenic
1026336563 7:69398871-69398893 AGTTTCCAACACATGAATTTTGG - Intergenic
1026400647 7:70009335-70009357 AGTTTCCAACACACAAACTTTGG + Intronic
1026507213 7:70995203-70995225 AGTTTCCAATACATGAACTCTGG + Intergenic
1026790273 7:73327150-73327172 AGTTTCCAACACATGAAATTAGG - Intronic
1026807988 7:73439774-73439796 AATTTCAAACACACAAACAGTGG - Intergenic
1027154841 7:75759554-75759576 AGTTTCCAACACATGAATTTGGG - Intergenic
1027211590 7:76153428-76153450 AGTTTCCAGCACATAAACTTTGG + Intergenic
1027389014 7:77686921-77686943 AGTTTCTAACCCATGAACTCTGG + Intergenic
1027566528 7:79801538-79801560 AGTTTCCAACACATACGCTTTGG + Intergenic
1027609381 7:80340580-80340602 AGTTTTCAACACACAAACTTTGG - Intergenic
1027683771 7:81255128-81255150 AGTTACCAACACATAAGCTTTGG + Intergenic
1029941487 7:104484953-104484975 AGTTTCCAACACATGAACTTTGG + Intronic
1030338530 7:108351058-108351080 AGGTTCCAACACATGAACTTTGG - Intronic
1030359782 7:108582761-108582783 AGTTTCCAACATACGAACTTTGG + Intergenic
1030378474 7:108782363-108782385 AGTTTCTAACACATAAATTTTGG + Intergenic
1030601838 7:111601951-111601973 AGTTTCCAACACATGCACTTTGG + Intergenic
1030680345 7:112427306-112427328 AGTTTCCAACACATGAACTTTGG + Intronic
1031035944 7:116787701-116787723 AGTGTCCAACACATGAACTTTGG + Intronic
1031332445 7:120482497-120482519 AGTTTCCAACACATGAAATTTGG - Intronic
1031418120 7:121517604-121517626 AGTTTCCAACACATGAAGTTTGG + Intergenic
1031632559 7:124062313-124062335 AGTTTTCAACACATGAACTTTGG - Intergenic
1031879503 7:127180360-127180382 AATTACCAACACAAAAAGTCCGG + Intronic
1032010080 7:128340188-128340210 AGTTTCCAACACATGAAATTTGG - Intronic
1032158519 7:129491210-129491232 TGCTTCCAACACACAAACTTTGG + Intergenic
1032230207 7:130067750-130067772 AGTTTCCAACACATGAACTGTGG + Intergenic
1032823475 7:135546208-135546230 AGTTGCCAACACATGAACTTTGG + Intergenic
1033059949 7:138096535-138096557 AGTTTCCAACACATGAATTAGGG + Intronic
1033195977 7:139327668-139327690 AGTTTCCAACATATGAACTTTGG + Intergenic
1033215790 7:139492645-139492667 AATTTCCAACACATGAATTCTGG + Intergenic
1033227960 7:139575667-139575689 AGTTTCTAACACAAGAACTTTGG - Intronic
1033737969 7:144243544-144243566 AGTTTCCAACTCATGAACTTTGG - Intergenic
1033745086 7:144307413-144307435 AGTTTCCAACTCATGAACTTTGG + Intergenic
1034056097 7:148036306-148036328 AGTTTCTAACACATGAACTTTGG - Intronic
1034313218 7:150108518-150108540 AGTTTCCAGCACATAAATTTTGG - Intergenic
1034793643 7:153992149-153992171 AGTTTCCAGCACATAAATTTTGG + Intronic
1035554771 8:558490-558512 AGTTTCCAACACAGGAACTTTGG + Intergenic
1035725257 8:1820813-1820835 AGTTTCCAACACATAAACTTTGG - Intergenic
1035863214 8:3052996-3053018 GGTTGCCAACTCCCAAACTCAGG + Intronic
1036087233 8:5625772-5625794 AGTTTTCAACACACAAACTTTGG - Intergenic
1037215756 8:16449122-16449144 AGTTTCCAACACATGAATTCTGG + Intronic
1037415501 8:18645187-18645209 AGTTTCTAGCACATGAACTCTGG + Intronic
1037540180 8:19863179-19863201 CGTTTTCAACACATAAACTTCGG - Intergenic
1037571411 8:20161032-20161054 AGTTTCCAACACACAAATTTTGG + Intronic
1037972881 8:23186826-23186848 AGTTTCCAACACATGAACTTTGG - Intergenic
1038003700 8:23412131-23412153 AGTTTCCAACACATGAACTCTGG + Intronic
1038161653 8:25045310-25045332 AGTTTCCAACACATGGATTCTGG + Intergenic
1038556600 8:28523780-28523802 AGTTTCCAATACATGAACTTTGG - Intronic
1038726270 8:30085030-30085052 AGTTTCCAACACATGAGCTTTGG - Intergenic
1038728521 8:30104236-30104258 ATTTTCCTACACACAAAATATGG - Intronic
1039134689 8:34308347-34308369 AGTTTCCAACACATGAGCTTTGG - Intergenic
1039853787 8:41395429-41395451 AGTTTCCAACACTTGAACTTTGG + Intergenic
1041213014 8:55571749-55571771 AGTTACCAAAAAACAAGCTCAGG + Intergenic
1042076543 8:65001485-65001507 AGTTGCCAACACATGAACTTTGG + Intergenic
1042197023 8:66239526-66239548 AGTTTCCAACACATGAACTTGGG + Intergenic
1042248027 8:66727495-66727517 AGTTTCCAACACATGCACTGTGG - Intronic
1042481818 8:69312970-69312992 AGTTTCCAACACATGAACTGGGG + Intergenic
1042935450 8:74053730-74053752 AGTTTCCAACACATGAAATTTGG - Intergenic
1043056896 8:75450713-75450735 AGTGTCCAACACATGAACTTTGG - Intronic
1043469447 8:80547801-80547823 AGTTTCCAACACATGAACTTTGG + Intergenic
1043624958 8:82244750-82244772 AGTTTCCAACACATGAACTTTGG - Intergenic
1043654952 8:82651566-82651588 TGTTTCCAACACATAAAATTTGG + Intergenic
1044095682 8:88061204-88061226 ATTTTCCAACTCACTGACTCTGG - Intronic
1044554833 8:93551846-93551868 AGTTTCCAACACATAAACTTTGG + Intergenic
1044925711 8:97207053-97207075 AGTTTCCAACACATGAACTTTGG + Intergenic
1045046721 8:98285944-98285966 AGTTTCCAACACATGAACTTTGG - Intronic
1045683255 8:104685098-104685120 AGTTTCCAATACATGAACTTTGG + Intronic
1045830919 8:106459137-106459159 AGTTTCCAACACATGAACTTTGG - Intronic
1046196637 8:110872561-110872583 AGTTTCCAAAAAACAAACGAAGG + Intergenic
1046471533 8:114681832-114681854 AGTTTGCAACACATAAACTTTGG + Intergenic
1046581442 8:116097974-116097996 AGCTTCCAACACATGAACTTTGG - Intergenic
1047006399 8:120624552-120624574 AGTTTCTAACACATGAACTTTGG + Intronic
1047006476 8:120625206-120625228 AGTTTCCAACACATGAACACTGG + Intronic
1047310923 8:123691149-123691171 AATTTTCAGCACAAAAACTCAGG - Intronic
1047425588 8:124742595-124742617 AGTTTCCAAAACATGAACTTTGG + Intergenic
1047491980 8:125382643-125382665 AGTTTCCAACACATGAAATTTGG + Intergenic
1047568310 8:126070756-126070778 AGTTTCCAACACATGAACTTTGG + Intergenic
1047795275 8:128248829-128248851 AGTTTCCAAGAGACAAATACTGG - Intergenic
1047799355 8:128292827-128292849 AGTTTCCAACACATGAAATTTGG + Intergenic
1047913944 8:129561488-129561510 AGTTTCCAACACATGAACTTTGG - Intergenic
1048235709 8:132688187-132688209 AGTTTCCAACACAGCCACTTTGG + Intronic
1048362271 8:133708174-133708196 AGTTTCCCCCAGTCAAACTCAGG + Intergenic
1048601897 8:135927460-135927482 AGTTTCCAACACATAAACTTTGG - Intergenic
1048666658 8:136669664-136669686 AATTTCTAACACATAAACTTTGG - Intergenic
1048672102 8:136734260-136734282 AGTCTCCAACTCCCAAACTCAGG + Intergenic
1048885736 8:138907954-138907976 AGTTCCCAACACATGAACTTTGG + Intronic
1050415497 9:5412371-5412393 AGTTTCCCACACATGAACTTTGG - Intronic
1050420649 9:5461278-5461300 AGTTTCCCACAAAGAAACTGAGG - Intronic
1050463705 9:5898494-5898516 AGTTTCCAATACACGAATTTTGG + Intronic
1050765416 9:9127114-9127136 AGGTACCCACACACACACTCAGG + Intronic
1050770269 9:9190078-9190100 AGTTTCCAACACATGAACTTTGG - Intronic
1050802791 9:9637121-9637143 AGTTTCCAACACATGAATTGTGG + Intronic
1051306577 9:15716870-15716892 AGTTTCCAACACGTGAACTTTGG + Intronic
1051469769 9:17424642-17424664 AGTTTCCAACACATAAAACTTGG - Intronic
1051912589 9:22171480-22171502 AGATTGCAACACAAAAACCCTGG - Intergenic
1052182526 9:25547169-25547191 AGTTTCCAACACATGAAATTTGG - Intergenic
1052300068 9:26944002-26944024 AGTTTCCAGCACATGAACTTTGG - Intronic
1052464761 9:28816226-28816248 AGTTACCAACACATGAACTTTGG + Intergenic
1052672561 9:31576913-31576935 AATTTTCAACACACAAAATTTGG + Intergenic
1052680835 9:31690379-31690401 AATTTCCAACACATGAACTTCGG - Intergenic
1052830058 9:33207797-33207819 AGTTTCCAACACATAAACTTGGG + Intergenic
1053027706 9:34744104-34744126 GGTTTCCAACACATGAACTTTGG + Intergenic
1053034363 9:34811291-34811313 AGTTTCCAACACATGAACTTTGG - Intergenic
1053044226 9:34900684-34900706 AGTTCCCAACACATAAAGTTTGG - Intergenic
1053450642 9:38191574-38191596 AGCTTCCAACACATGAACTTTGG + Intergenic
1053459682 9:38258598-38258620 AATTTCCAACACACGAATTTTGG + Intergenic
1053837912 9:42160537-42160559 TGTTCCCAACACTCAGACTCAGG - Intergenic
1053883107 9:42615593-42615615 TGTTTCCAACACTCAGACTCAGG + Intergenic
1053889562 9:42678706-42678728 TGTTTCCAACACTCAGACTCAGG - Intergenic
1054222132 9:62423066-62423088 TGTTTCCAACACTCAGACTCAGG + Intergenic
1054228582 9:62486106-62486128 TGTTTCCAACACTCAGACTCAGG - Intergenic
1054757877 9:68977303-68977325 AGTCTCCAACTCCCAACCTCAGG - Intronic
1054806617 9:69401906-69401928 AATTTCCAACACATGAATTCTGG + Intergenic
1055161485 9:73133868-73133890 AGGTTTCATTACACAAACTCAGG + Intergenic
1055251342 9:74310240-74310262 AGTTTCCAACACAGATACTATGG + Intergenic
1055388682 9:75794712-75794734 AGTTTCCAACCCATGAACTTTGG + Intergenic
1055450103 9:76423224-76423246 AGTTTCCAACACATGAACTTTGG - Intronic
1056603059 9:88061551-88061573 AGTCTCGAACACCCAACCTCAGG + Intergenic
1056635819 9:88330445-88330467 AGTTTCCAACACATAAATTTTGG + Intergenic
1056891987 9:90502834-90502856 GGTTTCAAACTCACAACCTCAGG - Intergenic
1057640238 9:96812739-96812761 AGTTTCCAACATACGAACTTTGG + Intergenic
1057849310 9:98552476-98552498 AGTTCCCAACACACACAGCCTGG - Intronic
1058546110 9:106061718-106061740 AGTTTACAACACATGAACTTTGG - Intergenic
1059069267 9:111118239-111118261 AGTTTCCAACACACGAACCATGG + Intergenic
1059304546 9:113343660-113343682 AGTTTCCAGCACATGAACTTTGG + Intergenic
1059463766 9:114452381-114452403 AGTTTCCATCACGCAAATTCAGG + Intronic
1059477138 9:114556502-114556524 AGTTTCCAACACATGAAATTTGG - Intergenic
1059510290 9:114839098-114839120 AGTTTCCCACACATGAACTTTGG + Intergenic
1059820710 9:117969244-117969266 AGTTTCCAACACATAAACTTTGG + Intergenic
1059877233 9:118648041-118648063 AATTTCCAACACATAAAATTTGG - Intergenic
1060810631 9:126609995-126610017 AGTTTCCAGCACTCAGTCTCTGG + Intergenic
1061619511 9:131802525-131802547 AATTTCCAACACACTAACCCAGG + Intergenic
1061785682 9:133026692-133026714 AGTTTCCAACACATGAAATTTGG + Intergenic
1062751168 9:138254791-138254813 AGTTTCCAGCACATAAACTTTGG - Intergenic
1203368187 Un_KI270442v1:276589-276611 AGTTTCCAACACTTGAGCTCGGG + Intergenic
1186170144 X:6868051-6868073 AGTTTCCAACACATGACCTTTGG + Intergenic
1186558311 X:10584262-10584284 AGTTTCCAACAAACGAATTTTGG + Intronic
1186734291 X:12444885-12444907 AGTTTCCAACACATGAACTTTGG + Intronic
1186765216 X:12763646-12763668 ATTTTTCAACACATAAACTTTGG + Intergenic
1186877193 X:13828178-13828200 AGTTTCCAACACATGAAATTTGG - Intronic
1186926848 X:14343060-14343082 TGTTGCCAACACATAAACTTTGG + Intergenic
1187081344 X:15992053-15992075 AGTTTCCAATACATAAACTTTGG - Intergenic
1187085373 X:16037128-16037150 AGTTCCCAGCACATAAACTTTGG - Intergenic
1187292003 X:17963556-17963578 AGCTTCCAACACATGAACTTTGG + Intergenic
1187305445 X:18091310-18091332 AGTTTCCAACAAATGAACTTTGG - Intergenic
1187520340 X:20007900-20007922 GCTTTCCAACAGAGAAACTCTGG + Exonic
1187549977 X:20292841-20292863 AGTTTCCAACACAGGAACTTTGG - Intergenic
1187614447 X:20977811-20977833 AGTCTCCAACACAAGAACTTTGG + Intergenic
1187784107 X:22865417-22865439 AGTTTCCAATACACGGACTTTGG - Intergenic
1187802811 X:23082863-23082885 AGTTTCCCACACATAAATTGTGG + Intergenic
1187971140 X:24659896-24659918 AGTTTCTAACACATAAACTTTGG + Intronic
1188032625 X:25281744-25281766 AGTTTTGAACACACGAACTTTGG - Intergenic
1188033082 X:25285816-25285838 AGTTTCCAACACATGAACTATGG + Intergenic
1188380390 X:29484443-29484465 AGTTTCCAACACATAAAGTTTGG + Intronic
1188520049 X:31028978-31029000 AGTTTCCAACACATGAACTTCGG - Intergenic
1188599919 X:31949645-31949667 ATTTTCCAACAAAAAAACCCAGG - Intronic
1188611315 X:32101787-32101809 AGTTTCCAACACATGAAATTTGG - Intronic
1188727254 X:33601282-33601304 AGTTTCAAACACATGAACTTTGG + Intergenic
1188961737 X:36501301-36501323 AGTTTCCAAAACATGAACTTTGG - Intergenic
1189712385 X:43826883-43826905 AGTTGCCAACACATAAATTTTGG + Intronic
1189895515 X:45651548-45651570 AGTATCCAACACAGACCCTCTGG + Intergenic
1189973076 X:46437627-46437649 AGTTTCCAACACATGAACTTTGG + Intergenic
1190149375 X:47931015-47931037 ACTTTGCAACAGAAAAACTCAGG - Intronic
1190710150 X:53062178-53062200 GGTTTCCAACACATGAACTTCGG + Intronic
1191731748 X:64343704-64343726 AGTTTTCAATTCACAAACTAAGG + Exonic
1192272834 X:69599563-69599585 AGTTTTCAACACATGAACTTTGG + Intergenic
1192337004 X:70229993-70230015 AGTTTCTAACACATGAACTTTGG + Intergenic
1192552489 X:72065298-72065320 AGCTTCAAACACCCAAACTTTGG + Intergenic
1192698418 X:73443150-73443172 AGTTTCCAACACACAACAAATGG - Intergenic
1192819850 X:74633486-74633508 AGTTTCCAACACATGAACTTTGG - Intergenic
1194108356 X:89799480-89799502 AATTTCCAACACATAAAATTTGG - Intergenic
1194109325 X:89812780-89812802 AGCTTCCAATACATAAACTATGG + Intergenic
1194151614 X:90331694-90331716 AGTTTCCAACACATGAACTTTGG + Intergenic
1194205650 X:91008403-91008425 AGTTTCAAACACATAAACTTTGG - Intergenic
1194406574 X:93503497-93503519 AATTTCCAACACATGAACTTTGG + Intergenic
1194465162 X:94225612-94225634 AGTGTTCAACACATAAACTTTGG - Intergenic
1194762310 X:97809394-97809416 AGTTTCCAACACATGAACTTTGG + Intergenic
1195315107 X:103669834-103669856 AGTTTCCAACACATGAGCTTTGG - Intergenic
1196729937 X:118930588-118930610 AGTTTCCAACACATGAATTTTGG - Intergenic
1196896289 X:120340029-120340051 AGTTTCCAACACATAAAATGTGG - Intergenic
1197316650 X:124974298-124974320 AGTTTCCAACACATAAACTTTGG + Intergenic
1197342490 X:125289569-125289591 AGTTTCCAACACATCAACATTGG - Intergenic
1197349117 X:125360412-125360434 AGTTTCCAAAACATGAACTTTGG - Intergenic
1197400948 X:125990328-125990350 AGTTTACAACACATTAATTCGGG - Intergenic
1197505754 X:127301934-127301956 AGTTTCTAACACATAAATTGAGG + Intergenic
1197629782 X:128845147-128845169 AGTTTCCAACAAACAAACTTTGG - Intergenic
1197827875 X:130610068-130610090 AGTTTCCAACATACACATTTTGG - Intergenic
1197895458 X:131308938-131308960 AATTTCCAACACATGAATTCTGG - Intronic
1198183359 X:134231394-134231416 ACATTGCATCACACAAACTCTGG - Intergenic
1198455716 X:136815734-136815756 AGTTTCCAACACATGAAATTTGG + Intergenic
1198561453 X:137854970-137854992 AGTTTCCAACACACAAATTTTGG + Intergenic
1198610180 X:138390349-138390371 AGTTTCCAACACATAATCATAGG - Intergenic
1198911882 X:141624245-141624267 AGTGTCCCACACACAGACTAGGG - Intronic
1198979486 X:142379156-142379178 AGTTTCCAACACATAAATTTTGG - Intergenic
1199477848 X:148265466-148265488 AGTTTCCAACACATGAATTCTGG + Intergenic
1199551436 X:149065886-149065908 AGAATCCAGCACACAAACACTGG + Intergenic
1199589352 X:149451963-149451985 AGTTTCTAACACATAAATTTTGG - Intergenic
1199936243 X:152576296-152576318 AATTTCCAACACATAAACTTTGG - Intergenic
1199992616 X:152996240-152996262 AGTTTCCAACACATGAACTCTGG + Intergenic
1200274780 X:154721600-154721622 AGTTTCCAACACATGAACTTTGG + Intronic
1200291942 X:154883802-154883824 AGTTTCCAAGACACACAATTTGG + Intronic
1200338780 X:155379539-155379561 AGTTTCCAAGACACACAATTTGG + Intergenic
1200347689 X:155461153-155461175 AGTTTCCAAGACACACAATTTGG - Intergenic
1200461014 Y:3454216-3454238 AATTTCCAACACATAAAATTTGG - Intergenic
1200461987 Y:3467522-3467544 AGCTTCCAATACATAAACTATGG + Intergenic
1200497973 Y:3908441-3908463 AGTTTCCAACACATGAACTTTGG + Intergenic
1200551408 Y:4583214-4583236 AGTTTCAAACACATAAACTTTGG - Intergenic
1200842303 Y:7795234-7795256 AGTTTCCAACACATGAATTTTGG - Intergenic
1201070512 Y:10143676-10143698 AGTTTCCAACACTTGAGCTCTGG - Intergenic
1201187899 Y:11421643-11421665 AATTTCCAACACATGAACTTCGG + Intergenic